Search Strains

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

Null allele of ben-1. Benzimidazole resistant. Can be used for benzimidazole resistance studies or selection. Reference: Hahnel SR, et al. PLoS Pathog. 2018 Oct 29;14(10):e1007226. doi: 10.1371/journal.ppat.1007226. PMID: 30372484.

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a West Mains allotment public vegetable garden near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Nov. 26, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 3, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 3, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): J. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 2 plot 43) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from a flower bed soil sample in the botanic gardens in Chungcheng, Taipei, Taiwan, September 29, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost from Jenny Pettifor's garden in the Paview neighborhood in Johannesburg, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): alpha. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): gamma. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Reference: Dolgin ES, et al. Heredity (Edinb). 2008 Mar;100(3):304-15. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost from the Olive Mushroom Farms near the town of Limuru, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis briggsae wild isolate. Isolated from compost from Jenny Pettifor's garden in the Paview neighborhood in Johannesburg, South Africa, on May 5, 2006. Landscape: Urban_garden. Isolated from a compost sample from a private garden in Johannesburg, South Africa, March-April 06 by E. Dolgin. Same compost sample as ED3078-3089. WBPaper00035666. GPS: -26.200001 28.000000, Johannesburg, South Africa. Substrate: compost_heap. Sampled_by: Elie Dolgin WBPerson12345. 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis briggsae wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis briggsae wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

upIs1 [mup-4::GFP + rol-6(su1006)]. Rollers. [NOTE: 11/2006: Pamela Hoppe determined that the strain is homozygous for mup-4.]

Dpy suppresses Rol and Lon. Strain appears to be only Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-5 causes extreme dumpiness, rol-6 causes worms to roll over and lie in a "C" shape, and lon-1 worms are about 125% WT length.

Dpy suppresses Bli and Lon. Strain appears to be only slightly Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-11 causes dumpiness, bli-6 adult worms develop blisters on their bodies, and lon-2 worms are about 150% WT length.

At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.

At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.

Abnormal posterior body muscle contractions during defecation. Derived by single outcrossing of MT1733; allelic to n2303.

Isolated by Michael Ailion from rotting apricot from home of Wayne Davis and Danielle Endres in Salt Lake City, Utah, 8/4/2006, under tree on north side of house. Coordinates: 40° 42' 26.16" N, 111° 52' 3.27" W. Animals move very rapidly. Strain started from a single L4 hermaphrodite and grown three generations before freezing. 18S rDNA sequence differs from C. briggsae NCBI entry (PB102), but is identical to the 18S sequence of AF16, HK104, PB800 and VT847. Cross-fertile with AF16. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Mixed "strain" started from many different worms that emerged from the same apricot that gave rise to strain EG4181. Some worms emerged as dauers, but there were also L4s and adults. Consists of a mix of the worms that came from the apricot to try to maintain as much diversity as possible in the population and thus is not a true strain in the traditional sense. It will be sent as contaminated worms since it cannot be cleaned up without going through a bottleneck. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Utah natural isolate carrying peel-1(qq99) I. EG4348 was collected by M. Ailion from Salt Lake City, UT. qq99 designates the naturally occurring nonsense mutation in peel-1. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).