Search Strains

axIs1677 [pie-1p::GFP::histone H2B::pgl-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1681 [pie-1p::GFP::histone H2B::him-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1688 [pie-1p::GFP::histone H2B::mex-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1691 [pie-1p::GFP::H2B::him-3 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.

axIs1630 [daz-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)].

axIs1694 [gld-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)].

axIs1696 [pie-1p::GFP::histone H2B:pgl-3 3'utr , unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1703 [spe-11p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)].

axIs1709 [pie-1p::GFP::histone H2B:lip-1M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.

axIs1713 [pie-1p::GFP::histone H2B::mes-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is very unstable. Pick non-Unc, GFP+ worms to maintain.

axIs1715 [pie-1p::GFP::histone H2B::pie-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1716 [pie-1p::GFP::histone H2B::unc-54 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.

axIs1717 [pie-1p::GFP::histone H2B::spe-41 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1742 [lip-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)].

axIs1721 [pie-1p::GFP::histone H2B::puf-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1722 [pie-1p::GFP::histone H2B::fog-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1751 [pie-1p::GFP::histone H2B::pos-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.

axIs1752 [fbf-1p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Maintaining at 25C might reduce the chance of transgene silencing.

axIs1756 [fbf-2p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Maintaining at 25C might reduce the chance of transgene silencing.

axIs1758 [spn-4p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.

axIs1759 [msp-56p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)].

axIs1723 [pie-1p::GFP::histone H2B:gld-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.

axIs1779 [pie-1p::mCherry::H2B::tbb-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.

axIs1775 [pie-1p::GFP::histone H2B:gld-1 M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Pick wild-type worms to maintain.

axIs1723 [pie-1p::GFP::H2B::gld-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.

axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.

axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.

axIs1849 [pie-1p::GFP::H2B::htp-3 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.

axIs1851 [pie-1p::GFP::H2B::rad-51 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.

axIs1864 [pie-1p::GFP::H2B::zim-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in mitotic germline; variable, sometimes weak, GFP expression in pachytene stage.

axIs1890 [pie-1p::GFP::H2B::msh-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Weak GFP expression in mitotic germline; GFP expression in pachytene, oocytes, and embryos.

axIs1895 [pie-1p::GFP::H2B::rec-8 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.

axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.

axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.

axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. Reference: Zacharias A, et al. PLoS Genet. 2015 Oct 21;11(10):e1005585.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10286 [nob-1::GFP::unc-54 3'UTR + rol-6(su1006)]. stIs10286 contains 9kb promoter and full nob-1 transcript fused to GFP. Reference: Zhao Z, et al. PLoS Genet. 2010 Sep 2;6(9):e1001089.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs153 [ceh-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0622c06 by recombineering. Expression of transgene confirmed by GFP.

qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.

qSi26 [sygl-1p::H2B::GFP::sygl-1 3' end + unc-119(+)]. GFP expression in distal germ cell nuclei. teIs1 [oma-1::GFP + unc-119(+)]. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.

qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. teIs1 [oma-1::GFP + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi423 [gld-1p::GFP::H2B::gld-1 3'UTR(FBEa TGT to ACA & FBEa* TGT to ACA)[*rajSi50] + Cbr-unc-119(+)] II. Modification of gld-1 FBEa and FBEa* in gld-1 3'UTR of single-copy insertion transgene.  Qiu et al., in preparation.

qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."