| Strain | Species | Genotype | Add |
|---|---|---|---|
| VC20264 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20265 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20266 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20268 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20269 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC2027 | C. elegans | nhr-87(gk1283) IV. Show Description
Y41D4B.7. External left primer: GAAACCACAAATTACCCCCA. External right primer: AACCACATTTCGGCTGTTTC. Internal left primer: CACTTCATAGTGTGGGCGTG. Internal right primer: AGGATTCCGATTGACCTTCC. Internal WT amplicon: 2253 bp. Deletion size: 1371 bp. Deletion left flank: AAGTGACGTCACACTTCATAGTGTGGGCGT. Deletion right flank: ATAACTTACAGAGTGATGAAAGGAACGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC20270 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20271 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20272 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20273 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20274 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20275 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20276 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20277 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20278 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20279 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC2028 | C. elegans | lntl-1(ok1824) IV. Show Description
C31H1.6. External left primer: CCAAAGTCTCCTGCCCATTA. External right primer: ACATACCACCCGCTTTCTTG. Internal left primer: TTCAAACAATGATACCCGCA. Internal right primer: TTTTGAGGGAAATGCGAAAC. Internal WT amplicon: 2666 bp. Deletion size: 1550 bp. Deletion left flank: TTACAGGTCCATCAAAGCGGAATCCTTTAG. Deletion right flank: TTTTTGTTCAGGAAACTTTGAAACGCACAT. Insertion Sequence: TACGGACCTCGTTTGAATTTCAATCATCTTCATCAGCAACAACAGTTGCAGTGAGTTTT TGGGAAAATTTTTTTGAAAGTATAAATATTCGTTTTAGTTCAACAATCATTCCTTCGGA GTATCTCGGAGACAAGTCAGGATTTGAGTCCAGGTAAGGGATGAAGAAGGCAATTCCAA AAAATTTTTAAACAAAAAACGACTGTTTCACGGTGCTATTATAACAAAACCATATGAAT GTGATTTGGTTCGAACCATGCCTTTGCCATTTTTAAAACATCATTATAAATAGTTCTGC AAATTAATATTACAGAACTCTTCCATCGGAATCTATTATGTCAGCCAACAGCAGCAGTC TTGGATCTCACTGGAAGAGAATTGATTCGTTCACTAGTGGAAAATCTACCCAATCAATT CCCACTACAATTTCTTCGAAACCTCTAACTATTCCTTCATCGATTTCTGCCAACACCGC TTCCATCCCACCAAATCATGGTTCAGAATTTTCGAAAGATTTCAAGATGTCATCCTCAT CGAGCATGACTAGTGAGTATTCGGAAACCATCCATGGAAACTCGTTGGCATCTCTGGCT CCATCGTCACAAATATTGAGCTCTTTGGTTGAAACTACTGAGAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC20280 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20282 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20283 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20284 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20285 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20286 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20287 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20288 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20289 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20290 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20291 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20292 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20293 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20294 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20295 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20296 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20297 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20298 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20299 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20300 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20301 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20302 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20304 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20305 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20306 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20307 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20308 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20309 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC2031 | C. elegans | R07E5.1(ok2653) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R07E5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2653 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTTTTGGGCCATTTTGAG. External right primer: CCATTTTCACAGCGGCTAAT. Internal left primer: AATTAATTTTTCCAGGCGGC. Internal right primer: CACAAATTTCGAAGCCATCA. Internal WT amplicon: 1186 bp. Deletion size: 399 bp. Deletion left flank: ATTTGCTAAAGTTTGAGTTTACGGGTTTTT. Deletion right flank: CTGTCTGGGAGTGGGAGTGGGAAAAGAAAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC20310 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20311 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20312 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
| VC20314 | C. elegans | Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
- Job Opportunities within the CGC
- CGC Home
- Search Strains
- Register
(existing labs) - Request a Lab Code
(new labs) - Strain List
- Strain Donation
(Users must be signed in) - Request Knockout
(of Alzheimer's related genes) - Lab List
- Acknowledging the CGC
- Contact
- Frequently Asked Questions (FAQs)
- Conditions Of Use