Search Strains

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of rab-39. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTACCAATATCGTCTTATCGTTATTGGGGATTCAAC. Right flanking sequence: AGTTGGCAAATCTAGTCTTTTACGGTACTTCACAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATTGGGGATTCAACAGT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of cyn-11. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGATAACCCAATCGTTTTTCTAGAAGTTACCGC. Right flanking sequence: CGGTGGTGCACCAATCGGAACTATTGTTgtaagttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTAGAAGTTACCGCCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of lim-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ccacttttcagTCAAAAGAAGAAATCCTCCAAGT. Right flanking sequence: GAATTCGGCGTCTCGACCAGCACTGCCACGTCAGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCGAGACGCCGAATTCACT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F16F9.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACCATCATATAGCCCTCGCCGCCCTCCTCCACCA. Right flanking sequence: TACGAAGAGCAGAACAATCGAAATGCAAAAAAGgtg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTTCTGCTCTTCGTATGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of imph-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACTACAGGCCGTTCAACAGCAACAAGCCCAAC. Right flanking sequence: AGATGCACCATCGTCTTCAAGGAGCTCCGATCAATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGACGATGGTGCATCTGTT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F26G1.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCCCGAAAATTCGAAACCGACCCGGATTTGGTAA. Right flanking sequence: TTCCGGCCGTTCAACACCCGTTAGAAGACGCAGAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGACCCGGATTTGGTAATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tep-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGTACAAATGCAGCTGTGGTGTCAACAACCGCGG. Right flanking sequence: CGCCAGTTAAgtaagttctgtaaaatattgatgatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTTACTTAACTGGCGCCG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of dhp-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACCACTTGTTATCAAGAATGGAACTGTCGTCAATGA. Right flanking sequence: AGATGGAATGTTTAAAGCTGATGTTCTTGTTAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACTGTCGTCAATGAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of Y105E8A.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTATTCACTATTATGTGTCATTTACAAGTG. Right flanking sequence: ATTCGGTGACAATAAAAGATCCACCAACACTGGAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGTCATTTACAAGTGATT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of itm-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTGTGCGAGGCTGATGAGGAGAAGCACATCAGTAA. Right flanking sequence: CTGCGGCTGGGTACCAATGGAAGGAGGCAACTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GAGAAGCACATCAGTAACTG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of sfxn-1.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTCCGCCGATTCTTGCTCGTCTCGTTCCATTT. Right flanking sequence: GCTGCTATTGCATTCGCCAATGCAATTAATATTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCGAATGCAATAGCAGCAAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F21G4.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATAACGGATGAATTAAGTACAAATGTATCGTTG. Right flanking sequence: GACAGGGAATTAAACCTTTTGAAATCGGCACAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTACAAATGTATCGTTGGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F22G12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: caccaaaacccaaccaatttccagAGAACCTTTCGG. Right flanking sequence: CAATGGATTTCCTGCTCGGCAACGGAGCCGATGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCCAGAGAACCTTTCGGCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F33E11.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATGTTCGATATCAGCGATTGGCTCAGGAGTATA. Right flanking sequence: CGAAGgtgcggacgagaaaattttttttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTGGCTCAGGAGTATACGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. Penetrance lethal with lots of unhatched eggs and slow growth. CRISPR/Cas9 engineered STOP-IN null mutant of hint-3 into hint-1(sy1567) stop-in mutant. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catgttttacaggATGACGTCAATGCATACTTCTGT. Right flanking sequence: TAACGGATGCAAGTTTTGTGACATTGTCAAAAATA. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCAATGCATACTTCTGTTAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Isolated at Devil's Lake State Park, Lincoln City, OR. Off a path about 200 feet from a dock in wet, organic topsoil in a forest.

Isolated at 2151 Bunker Ridge Road, Eugene, OR. From damp grass compost in a field.

Isolated in northwest Hendricks Park, Eugene, OR. From under rocks over damp, organic soil. Isolated from a snail.

Isolated in northwest Hendricks Park, northwest rhododendron garden, Eugene, OR. From under rocks over damp, organic soil. Isolated from a snail.

Male-female strain. Low fecundity and fitness. PX356 is an inbred strain derived from EM464. Reference: Fierst JL, et al. PLoS Genet. 2015 Jun 26;11(6):e1005323. doi: 10.1371/journal.pgen.1005323. PMID: 26114425.

Male-female strain. Low fecundity and fitness. PX439 is an inbred derivative of isofemale line PB259 originally collected from a forest in Ohio (USA) by Scott Baird (Wright State University). Reference: Fierst JL, et al. PLoS Genet. 2015 Jun 26;11(6):e1005323. doi: 10.1371/journal.pgen.1005323. PMID: 26114425.

Male-female strain. Reference strain for the new chromosome-level assembly of the C. remanei genome. This is a natural isolate (BioProject PRJNA577507) inbred to reduce heterozygosity. Reference: https://www.biorxiv.org/content/10.1101/797035v1 (Accepted at Genetics).

Inbred strain with low fecundity and fitness. Originally collected in Wuhan, China. Reference: Adams PE, et al. Mol Biol Evol. 2023 Mar 4;40(3):msad039. doi: 10.1093/molbev/msad039. PMID: 36807460.

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxIs47 [rps-0p::5’ (delta)HygR::GCGAAGTGACGGTAGACCGT::3’ (delta)HygR::unc-54 3’::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

Superficially wild-type. Reduced dauer formation in response to specific ascarosides. Reference: Kim K, et al. Science. 2009 Nov 13;326(5955):994-8.

Superficially wild-type. Reduced dauer formation in response to specific ascarosides. Reference: Kim K, et al. Science. 2009 Nov 13;326(5955):994-8.

Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.

Superficially wild-type. Slight decrease in brood size and locomotion speed. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.

Caenorhabditis sp. 15 Isolated in Kaui (Hawaii) from unidentified wild rotten fruit.

Male-female strain. Wild type isofemale line of Caenorhabditis sp. 57. Isolated from a rotten fig collected from the forest floor, Barro Colorado Island, Panama, 23 August 2018. Coordinates 9°9.787, 79°50.232.

Male/Female, maintain by mating. Isofemale line isolated from rotting pwuhr fruit (Fagraea berteroana) in Kitti, Pohnpei, Micronesia (N 6.9066, E 158.1817), December 2023. Gonochoristic species in the Elegans Group (sister to C. kamaaina + C. oiwi). Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from rotting breadfruit flowers in Kitti, Pohnpei, Micronesia (N 6.8632, E 158.1765), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from rotting Citrus aurantifolia in Kitti, Pohnpei, Micronesia (N 6.8652, E 158.173), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from a rotting fruit at the Botanical Garden in Kolonia, Pohnpei, Micronesia (), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from rotting kotop (Clinostigma ponapensis) fruit in Kitti, Pohnpei, Micronesia (N 6.8577, E 158.2156), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Isolated by Annalise Paaby from an orange peel collected beneath a fig tree on State Street, Santa Barbara, CA (34.421629, -119.702021) in July 2010.

Isofemale line. Isolated by M. Rockman from a rotting palm fruit (?) on the Snyder-Molino trail on Barro Colorado Island, Panama (9°09.656' N, 79°50.490'W) on 4/24/12. Previously known as Caenorhabditis sp. 28.

Isofemale line. Isolated by M. Rockman from a rotten Gustavia superba flower on Barro Colorado Island, Panama (9°09.222'N, 79°49.564'W) on 4/25/12. Previously known as Caenorhabditis sp. 29.

umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim mKate2 expression in pharynx, and segregate heterozygotes (not paralyzed, dim mKate2), homozygous wild-type (not paralyzed, no mKate2), and hIn1 homozygotes (paralyzed, bright mKate2). Pick non-paralyzed, dim mKate2 worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived by crossing parental strain CGC105 (hIn1[umnIs78]) to RG3173 (Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)]) and selecting for the recombined hIn1 worms.

umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim GFP expression in pharynx, and segregate heterozygotes (not paralyzed, dim GFP), homozygous wild-type (not paralyzed, no GFP), and hIn1 homozygotes (paralyzed, bright GFP). Pick non-paralyzed, dim GFP worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived cross of parental strains CGC94 (hIn1[umnIs75]) to QP2460 (hIn1[umnIs78, unc-54(h1040)]/+) and selecting for the recombined hIn1 worms.

Superficially wild-type. Reference: Simske J & Dong Y. (2017). International Worm Meeting. The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis. WBPaper00051789.

Isolated in Christian Rocheleau's backyard in Montreal, Quebec, Canada.

C. briggsae wild isolate from Montreal, Canada (C. Rocheleau).

Male-female strain. Isolated by M. Rockman from rotting tomatoes in New Jersey, USA, July 2007. NOTE: To freeze this strain, heat shock at 37°C for 1 hr and add CaCl2 2mM in freezing solution.

C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.

C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.

Male-female strain. Maintain by mating. Isolated from garden soil in Buenos Aires, Argentina on 3/2/2012.

rdIs26 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.

rdIs27 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.