Search Strains

R134.1. External left primer: TTGCCATGGAACTCAAACAA. External right primer: TGAGAGCAGTGCAGTATGGC. Internal left primer: TGTTTGCTTGCCATTCACTC. Internal right primer: TGCTCCTTCGACAATCACTG. Internal WT amplicon: 2561 bp. Deletion size: 1334 bp. Deletion left flank: ATGCTTCATAAGAAGCAAATGAGCATCACT. Deletion right flank: TTTATGGAGATATGACATACCCTGCAACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3493 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 531 bp. Deletion left flank: ATTGAGTTTTTTCTATGAAAGACCTAGCGC. Deletion right flank: AAAAATAAAATAAATAACACGGAAACCGCG. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W09C5.6. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3358 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACGTTACCATCAAGGCTCCA. External right primer: ATCGTCCCGTTTTGTGAGTC. Internal left primer: CTTCTGTTCTCCCCCAACCT. Internal right primer: TGCAAGTATGCTCCGTTGAA. Internal WT amplicon: 1101 bp. Deletion size: 640 bp. Deletion left flank: GACGGACACGAACTCTGTATGGAACGTTCT. Deletion right flank: AGTAGGAGCTTTATTTCAGAGAGAAAACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y111B2A.1. External left primer: GAAGCTCGAAGAGTGGGATG. External right primer: AGTGTATGCAGCGTGTTTGC. Internal left primer: CCTCTTTGAATTACCGCCAA. Internal right primer: TTTCAGATGAAACGTGCGAG. Internal WT amplicon: 2262 bp. Deletion size: 614 bp. Deletion left flank: TTAATTAATTTCACTGATTTACGCCTGTAA. Deletion right flank: AAAATTGTTTCCAGCCGCTGCGACAATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27C8. External left primer: CTGGAGCATTTGATTCGGTT. External right primer: ATTCATAAACTGGGAGGGGG. Internal left primer: TCCTCAACTTCGCTTCGAGT. Internal right primer: ATTTCGAACTTCATGCGGTC. Internal WT amplicon: 2141 bp. Deletion size: 227 bp. Deletion left flank: TCTTGATTCGATTTCACAGTGATGAATCAA. Deletion right flank: AATGTTTACATTTCCATTTCCAGGTCGATT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3521 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 378 bp. Deletion left flank: CTTCTCTTCTCCCTGTGTGTACCAGTGTAC. Deletion right flank: TCGAATCTGGAAATTTTGAAAATAAATTAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48B6A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3528 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTTTTCTCCGCACTCTGGT. External right primer: TGTGGCACAGAACTACGCTC. Internal left primer: CCAAAATGTTGCTCAACGAG. Internal right primer: CGCAAGCCTGTAAATGTGAA. Internal WT amplicon: 1182 bp. Deletion size: 614 bp. Deletion left flank: AAATGTTGCTCAACGAGATCAAAATCGATG. Deletion right flank: TAGGGGTACTGTAGGACAACTGTGGAAGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H28O16.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2203 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATCCTGACAGCTCGTTGG. External right primer: TTCGAAACAGGAGCTTTGCT. Internal left primer: TGTTGTCCAAACGCATTGTT. Internal right primer: ATTCTCGCAGAACACACACG. Internal WT amplicon: 2289 bp. Deletion size: 1121 bp. Deletion left flank: GACGTGTTGTTGACGCCCTCGGAAACCCAA. Deletion right flank: ATACCTCGACAAGGTCGACCCATCCGCCAT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3566 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. xternal left primer: CCAAAAACCGGAAAAAGACA. External right primer: AAAAACGTCCGATGCAATTC. Internal left primer: AGTGTTTCAAGGGAGGAGGG. Internal right primer: TCCATCCGTGACATCGTTTA. Internal WT amplicon: 1153 bp. Deletion size: 474 bp. Deletion left flank: ATTAGAAGTTCACGCAGTTATTTTTTCTAT. Deletion right flank: CTACAACGGAAACAACATTGAGCTCGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C009H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2466 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 550 bp. Deletion left flank: TATACTTGTATGAGTGAAGAATTTGATGAT. Deletion right flank: TCATCCAGCGAACAAACCTTCCACCATCAC. Insertion Sequence: CCATCGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y79H2A.3. Maternal-effect lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1219 homozygotes (Mel; F2 homozygotes arrest as early larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACATGCTTCTTCCATGCC. External right primer: AGCGAAATTTGGACTAGCGA. Internal left primer: TTCATTGCGTGATATTCCGA. Internal right primer: TCTGGACGTGTGCTACTTGC. Internal WT amplicon: 1396 bp. Deletion size: 1073 bp. Deletion left flank: GTTCATCACCAGCATTAATGAGATATCGAT. Deletion right flank: TAGCTAATTTTGAACCGCCATAAAACTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27D9.1. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3477 homozygotes (Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGTGGTCTGACATCGAACCT. External right primer: GGGGCTCTGAAAATGAAACA. Internal left primer: GAATTGCTGAACAAATCGCA. Internal right primer: GGGTTGAAATGAGCAATCATC. Internal WT amplicon: 1331 bp. Deletion size: 371 bp. Deletion left flank: TTACTCTTCAAGCAATGTGCTACGACCTTT. Deletion right flank: CAGTATCAACAAGGAGTTGACAAGTTGTGT. Insertion Sequence: AGACCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52E4.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3491 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACAGACGACGGAGACTTGCT. External right primer: TCGCTAAAGGACCCTCTGAA. Internal left primer: TATTGATTGGCGGCAGCTT. Internal right primer: GCGCGCACTGTATAAAATCA. Internal WT amplicon: 1126 bp. Deletion size: 427 bp. Deletion left flank: CAAAAGGAGAACATTGCTAAAATGTGTAGG. Deletion right flank: CAAACATACTTGACTTCTTTTCAGAACTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK370.7. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3492 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCAATCCGTTTCTGTCGTCT. External right primer: ATGATGCTCTTTCTCGGTCG. Internal left primer: TTGGCGAGAATTTATGAGCC. Internal right primer: TCGATGGATGGCAATTACAC. Internal WT amplicon: 1168 bp. Deletion size: 505 bp. Deletion left flank: TTAAGTTTATACAATTAAAGCTTTTGGCTA. Deletion right flank: TTTTTCAAACGATTTGAAAAAAAAACCCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F009G8.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3529 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACAACATGTGGCGATGATG. External right primer: GCTTCTTTCGTTTTTCCGTG. Internal left primer: GCAGAGTTCGAGACAGGACG. Internal right primer: CTCATTCCTCCACTTCGCAT. Internal WT amplicon: 1193 bp. Deletion size: 753 bp. Deletion left flank: AGACAGGACGTCGACATCTTGCCAAAATGA. Deletion right flank: ATTTTTAATTAAACAAATTTTCTCTAATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05H4.11. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2678 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGATTTTGAAGCTCGACGTG. External right primer: CGTAATGGCCTCATTCGTTT. Internal left primer: ATTCGAATGGAACCGAGTCA. Internal right primer: TTTCCCGTTTGTAACCTCCA. Internal WT amplicon: 2683 bp. Deletion size: 1414 bp. Deletion left flank: TTGTGTTTCAAATCGGACACTCTGCAAAAT. Deletion right flank: CCTTAGCAGCTTCAAAGTTAGTTGGGAGCT. Insertion Sequence: TCGTTTATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24D10.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3613 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGATGAGAACATCATCCT. External right primer: TCCTATTACATCGCCGTTCC. Internal left primer: AAATCAGAAAATCCGAAGAAAA. Internal right primer: CGACTTCCAGAGGATTGTCC. Internal WT amplicon: 1195 bp. Deletion size: 418 bp. Deletion left flank: TTGTCAATGGAGCGCGCTTACGCAGCTAAA. Deletion right flank: AGTTCCCCGGATTTCCCAGCGAATTTCCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R155.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk1217 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAGCAAATTTTTGCGGG. External right primer: AAGTACGCAAACACCTTGGC. Internal left primer: GCTAACTCGGCCTTTACACG. Internal right primer: TTTGGAAACCCGTTGGATTA. Internal WT amplicon: 2401 bp. Deletion size: 1464 bp. Deletion left flank: GTCGATTGGACCCAAAAAATAGAATTTTCA. Deletion right flank: GTGAAAAAGTACAAGAAATTCAACTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0252.1. Identified by PCR, validated by CGH. External left primer: GTAAGCAGCTGCATGGTTGA. External right primer: TGTCTGATTATTTGCCGCAG. Internal left primer: ACTCCCAAAGAGTTCACGGA. Internal right primer: GAATTCTGAACGGAACGGAA. Internal WT amplicon: 1940 bp. Deletion size: 1584 bp. Deletion left flank: AAATCAAAAGATTTGAACTTTCAAAGACTC. Deletion right flank: ATTTTCAACAGAAACCAAAATGTGAGATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01B2.1. Identified by PCR, validated by CGH. External left primer: CAAATCAGCGGAAATACGGT. External right primer: CTGCCCGCAATTAGAATGTT. Internal left primer: AAGATTCGTCCGATCTGTGG. Internal right primer: TTTAGGCCGAAGAGTTGCAT. Internal WT amplicon: 2534 bp. Deletion size: 806 bp. Deletion left flank: GATCTCAGGAGTGTTTTGAAATACACACCA. Deletion right flank: CATCATAGCAAAAAATCTTATTACAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09B4.7, F59A2.1. The allele gk1215 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CGTCTTTCACTCGCCTTTTC. External right primer: CAAAATGGAGAGTACCCGGA. Internal left primer: TATTCTGTATGACGCCGCAC. Internal right primer: CCGGCCTGATCTGAGAGTAA. Internal WT amplicon: 2551 bp. Deletion size: 661 bp. Deletion left flank: AAAGAAATAAAGCTCCAGATGATATCACGT. Deletion right flank: GGAAAGCAACTTATCATTTCCCATACCAAC. The allele gk3059 was identified by CGH but not confirmed by PCR. Left flanking probe: TTCCATTCTCAATATTTGAAGGGAGTGTCTCCTCCGAAATGGTCACCTGG. Right flanking probe: CAGAACATGGTTTGCTCTCCTTCTTCTCCAGTTTTCACCTCGACAAGATC. Left deleted probe: GTCTCCTCCGAAATGGTCACCTGGTCTCGTCGCATAACAACTCTCCACGA. Right deleted probe: CGTTGGCATAAATGTAGAGTTTTGAACGATTGCAGAACATGGTTTGCTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54E7.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3603 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGCATAACACGAAACGAA. External right primer: ACCCGAGCCCTGATAAAAAG. Internal left primer: GCGATTTGTGCGTCAGTAAA. Internal right primer: TTTAAGTTCTAAACCGTCATTGG. Internal WT amplicon: 1236 bp. Deletion size: 437 bp. Deletion left flank: ACTTTCGAATGCATCCGTTGGATATTTAAA. Deletion right flank: CTACGCACTGATCCTCTCATGTCTTGGATA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H43I07.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3654 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGACCTACGACGAATGCACC. External right primer: GGCAATTAACCGAAATCGAA. Internal left primer: AAATCCAAGTGGCAATGGTC. Internal right primer: GCAAATTGCCGAAAAAGAAA. Internal WT amplicon: 1310 bp. Deletion size: 688 bp. Deletion left flank: TTCTGCCGCTTCGTGTGGATCCACGTGGAT. Deletion right flank: ACATCTACCTATATTCAGTATATTTAGACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45H11.6, F09A5.2. The allele gk1216 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 646 bp. Deletion left flank: GATGAAGAATGAGAAAGGAAATATTTGAAG. Deletion right flank: AATAATGTTGTCTGGTACAGGTATCAAATC. The allele gk3060 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right flanking probe: TGGTGAGTGACCTTTCCATAAACCGAATTACCTCGGAAAATGTTTTTAGA. Left deleted probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right deleted probe: GAGAAGACATAAAGATTATGTGCTGATGGTGAGTGACCTTTCCATAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C40D2.4. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 518 bp. Deletion left flank: TCTCCTCAAATGCTGAAAGTGAATAAAGAA. Deletion right flank: CAAAAAATATTTTTCAAAAGATAACATAAA. Insertion Sequence: AGGTGATCTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3177) in R09D1.13, detectable by PCR using the following primers. External left primer: GCAATCGGGATGTTCTGAAT. External right primer: TGTTGGAGAAACTGTGCGAG. Internal left primer: ACAACGAAACATCGTCGGAT. Internal right primer: ATAAATATGGATGCCGCCAA. Internal WT amplicon: 2530 bp. Deletion size: approximately 1400 bp. Validation: gk3177 passed by CGH. Left deleted probe: AGGATCAATTTCGACTGGAATGTTGCCTATACTAATATTATCTCGAATGC. Right deleted probe: AATTAATATAACTAGATCCATTGCCATTTTCGGTTTGGCTGGAACATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09E4.1. Identified by PCR, validated by CGH. External left primer: TCGGCAAATGTGGTTTTGTA. External right primer: CGAGTTCTCTTCCTCAACCG. Internal left primer: ACACAATGGAGCAGCATCAG. Internal right primer: GGCAATCTTGTGGAACACCT. Internal WT amplicon: 1905 bp. Deletion size: 753 bp. Deletion left flank: CAAATTTTTTTGCCGATTTGCCGGAAATTT. Deletion right flank: GCGATGCGGAACAAGTTCACGCTTGGGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52B9.3. Identified by PCR, validated by CGH. External left primer: ACATTTTTGTGGCCTTTTCG. External right primer: ATTCCCTTCTCATCCCTGCT. Internal left primer: TTTTCACTTGTCCCTCGACTTT. Internal right primer: TCGTTGAATGTATTTGCAGGTC. Internal WT amplicon: 1349 bp. Deletion size: 448 bp. Deletion left flank: AAATGTGTGCTCAGTTTTTGTTTGCGAAAA. Deletion right flank: TATCAGGTTTGTAGATCACGTTTTCCACTA. Insertion Sequence: CCCTTTAAAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2021.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATGGATATCAGCGCTCAGG. External right primer: TTGCTACTTGCCAGCACATT. Internal left primer: CAAATGGTTCATAGAAGAACTCAGC. Internal right primer: CTGTTGAAAGTTGAGTGGCG. Internal WT amplicon: 1147 bp. Deletion size: 554 bp. Deletion left flank: GACAATAGGAAGGAAGCTCAAAGTCTGGAA. Deletion right flank: TGGGGCACCAAGTTCACGGCATGAATACTG. Insertion Sequence: AGTCTGGAAAGTCTGGAAAAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y75B8A.6. External left primer: ACGGATCCCTGAACAGAATG. External right primer: TATATTCACGGGGTTCTGGC. Internal left primer: TTGCTGGAGAGAAAAACGGT. Internal right primer: GGAAACCAGAAATCCGTGAA. Internal WT amplicon: 3060 bp. Deletion size: 903 bp. Deletion left flank: ATACGAAAAAATTCAAAAATTCAAAAAGGA. Deletion right flank: TATATTGAACTCGTTTCACATCAAAATGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03A10.3. External left primer: TGCTGGAGTAGAGCGGGTAT. External right primer: GCAGAGAGCCTGAAAATTGC. Internal left primer: CCTTGTGGAAGGCCTTGTT. Internal right primer: GCACAGCCCTGATTCCTACT. Internal WT amplicon: 1181 bp. Deletion size: 621 bp. Deletion left flank: CAGTTTTTTTCCGTTTCACTTACCACATCG. Deletion right flank: CCCAACTACAGAATGATGCGAATCGTAGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44F4.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3651 homozygotes (sterile giving unfertilized eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATAAGCCGGTGTGATACGG. External right primer: TCGATGTCTGATTGCAGCTC. Internal left primer: ATCGATTTGAAGCGAAGGC. Internal right primer: GTCAATTGAATCCGGAGCAT. Internal WT amplicon: 1211 bp. Deletion size: 555 bp. Deletion left flank: ATGGAATGATCCAAAACGAAGAGATTCATT. Deletion right flank: ACTGAACTTCCCCGGCTCAACAAGCAGTGA. Insertion Sequence: TCTCGAAGAGATTCATTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F29B9.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3628 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAGCTTATCAAGCACACGA. External right primer: AACCGCGTGAAAGAATATGG. Internal left primer: CATCTCCGGACACCACTACA. Internal right primer: GCTTCTTCATGAGGCGATCT. Internal WT amplicon: 1193 bp. Deletion size: 823 bp. Deletion left flank: ATCAAGGAAGGTCAGACACTGCTCATCCCG. Deletion right flank: ACTATTGTGGATCCCATCTCGAAGCACGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06H2.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3630 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGTGAACAAATGGGCAA. External right primer: AATGCGATTGAGATGAAGCA. Internal left primer: TCGAAGAATGAGTCGAGCAA. Internal right primer: TGGACCTGAAAACCAAATGA. Internal WT amplicon: 1341 bp. Deletion size: 975 bp. Deletion left flank: ATTCCTAAAAACGAATTAACCCAAAGTTTG. Deletion right flank: AATGACAGTCTAGGTGTATCTAGAAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32A7.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3586 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGTGCGTTATTTCGGAGC. External right primer: CTTTCATCCGTCATTGCTCA. Internal left primer: GACTATTTCTTCGACATTTTATTGC. Internal right primer: GGGTAGATTTTGAAAAAGAAACG. Internal WT amplicon: 1238 bp. Deletion size: 539 bp. Deletion left flank: ATTTGAGGTAAACGAAAAAATAATATAAAA. Deletion right flank: GGCAAGATTAGCCCCAAACTATGCAGAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y87G2A.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3599 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTCTGAGCCTCAACCAAAA. External right primer: CTCTCACTCAAAATGCGGGT. Internal left primer: CAGAATTTTGAGAAAATCCAACG. Internal right primer: AGTTTGTAGCCCCTCAGCCT. Internal WT amplicon: 1205 bp. Deletion size: 621 bp. Deletion left flank: ACCAAATCGGACCGAATGTGCACTTCGTGT. Deletion right flank: ATCAGTTGATTCATCAGGGTACTCGACTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52C12.2, F52C12.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3019 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTCTATTTTTCCCCCGAAG. External right primer: TTGCATCTTGCGGTAGACAG. Internal left primer: TTCGGAGCTTCGTTGTTTCT. Internal right primer: ATCCCGTCTCAATTGTCGTC. Internal WT amplicon: 3351 bp. Deletion size: 2297 bp. Deletion left flank: AATTTTAAAATTTTAATTCCTTGTGGCAAA. Deletion right flank: CGACTCGGAAGGCGAAATGGATTTTGAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06C10.4, T06C10.6, T06C10.3, cTe154X.1. The gk1263 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 1036 bp. Deletion left flank: ACAAAATAAACGAGTTTAAAAAAACATTCA. Deletion right flank: TAACAAGGTACAATGGTTCCTGTAGTACTC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C40D2.4, Y102A11A.2. The gk1252 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 547 bp. Deletion left flank: AAATTGCAATCGCTTCCGGTAAAATTACTT. Deletion right flank: GTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATA TGTATATGTATATGTATATGTATATGTATATGTATATGTTTATGTATATGTATATGTAT ATGTAAATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTA TATGTATATGTATATGTATATGCTGAAAGTCGA. The gk3151 allele was identifed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45H11.6. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 572 bp. Deletion left flank: GAAATATTTGAAGTAAAAATAATAATACAT. Deletion right flank: TTGAATGCCAGTTTTAAGGCACACACTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49C3.13, W03G11.3. The gk1251 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AATGGAAAACGTTTGAACTTTGTAG. External right primer: AATTCAATCCATCATTTTCTGTGTT. Internal left primer: CATTGCCAAAAGGTGTCATAAA. Internal right primer: CCATCTTGGTACGATGACTCAA. Internal WT amplicon: 2027 bp. Deletion size: 969 bp. Deletion left flank: TATGATACAATGACTAAATATCGTAATCAG. Deletion right flank: TCCCCAATGACAGAATATGCCAAACTTTGA. The gk3149 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54D1.1, F55G1.5. The gk1250 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCACGTTGCGAAGTAGATGA. External right primer: GCGGTACAACGATTGAAGGT. Internal left primer: TCGTTGCCTGTTGTATGGAA. Internal right primer: CCGATGAAATGGCAAAATCT. Internal WT amplicon: 1387 bp. Deletion size: 621 bp. Deletion left flank: AGTCGTAATCACCACACCAATGGAGCTATT. Deletion right flank: TGCGTCGGTTTCGCCTAGAGCATTTATTTT. The gk3148 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1282) in C35D6.4, detectable by PCR using the following primers. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: AGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC. Validation: gk1282 passed by CGH with low log2 scores. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38F1A.1, F56H6.6. The gk1246 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCACCCCATTGTTGAACTTT. External right primer: ATGCCACGTAGCAAAAATCC. Internal left primer: TTCCCAAACACAAGAATCCC. Internal right primer: GCTAAGAGATATCGCGCGTC. Internal WT amplicon: 1616 bp. Deletion size: 617 bp. Deletion left flank: GCTCGACAGGGTTGACATGCCAGAACGCGT. Deletion right flank: TCCCGGTGATTGTAAGGTCTTTAGACATAT. The gk3146 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07B5.6, C40D2.4. The gk1258 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 942 bp. Deletion left flank: ATGAGTGATTTACTTTTAAAACTTGAAAAT. Deletion right flank: ATATGTATATGTATATGTATATGTATATGT. The gk3145 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 182 bp. Deletion left flank: ATCATACCGAACTGCGGTCCTGCTGCCTGT. Deletion right flank: GCCAGAGAGCCCTAGAACTTCTTGTGCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 268 bp. Deletion left flank: TCCCACCGGACGGCGCACGCAACAGCCCGT. Deletion right flank: TTTGAAATTCAAACTGATCTTCTAACAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C35D6.4. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: TGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38C2.7. External left primer: TGCTCCAGTGTGCACAAAAT. External right primer: TTCACAGAGAGTGTGGCCTG. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: TGTTGAAGCAAGCAACCAAG. Internal WT amplicon: 598 bp. Deletion size: 392 bp. Deletion left flank: CACCTGATTCCGTACTTGCAATGCCCAGTT. Deletion right flank: TTCTTGGTTGCTTGCTTCAACAGACATTGT. Insertion Sequence: CTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807