Search Strains

F41G3.10. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2840 homozygotes (sickly Unc with small broods, often Dpy, various morphological defects; population can be maintained with difficulty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGATCATTCGAGTGGGAAGA. External right primer: GTCCACTAAACTTTGCCCCA. Internal left primer: AAATTGAGGATGGATGACGC. Internal right primer: AAACTCCCACGAAATCATGC. Internal WT amplicon: 1146 bp. Deletion size: 795 bp. Deletion left flank: TGTTGCAATAAGAACGCATAGCTGTACAAT. Deletion right flank: GTGTCTAACTGTGAACGAGTGGGCTTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2877 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATTCTGGACAGCGTTTGCTT. External right primer: CCATGATTAAACCAGACGGG. Internal left primer: TCAATCCATTGGGCATTTTT. Internal right primer: GGAATTACCTGCAATGGCTC. Internal WT amplicon: 1331 bp. Deletion size: 689 bp. Deletion left flank: AGATAATAATTTATACGAGAATATAGAATC. Deletion right flank: GGTTTCGTCATTTCTCGATAGAATTTGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54C9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2829 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAACCGCCAACGAGTACAAT. External right primer: CAACGGGATCATTGCTAGGT. Internal left primer: GCTAAAGCTGCCGTAATTGG. Internal right primer: TGGATTACCTCCACCACCTC. Internal WT amplicon: 1183 bp. Deletion size: 642 bp. Deletion left flank: TGCTTGAGTTACAAAAACTCCTCCTTGAAG. Deletion right flank: TCATTAAAACTTACAAGAAAGCAACGACAC. Insertion Sequence: TTAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52H3.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2786 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTAGCGAAGCATTTTTGCCT. External right primer: CGACCCGAAGAATTGACATT. Internal left primer: GGAAAAACGCGACTGTCAAT. Internal right primer: CACGAAAATTATCGGGATGC. Internal WT amplicon: 1138 bp. Deletion size: 467 bp. Deletion left flank: AGTTCATGCAAGACTGAACAAGAAGACCAC. Deletion right flank: CTGAAAGTGTTTCAAGAAGGCATGGTATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK930.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3132 homozygotes (larval arrest). This strain exhibits a high level of sterility or near-sterility in heterozygotes and mIn1 homozygotes, but populations can be maintained. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATAGGTGGATGGCTGGAAA. External right primer: CGAAATGTTGGCTCATCTCA. Internal left primer: TCTCCTTGGCTTCTGTGTCC. Internal right primer: GCTCACTTGGCTCTTCGTCT. Internal WT amplicon: 1200 bp. Deletion size: 789 bp. Deletion left flank: TGTCCAACACGGTGCGTTCATAAATTACAA. Deletion right flank: TTGTCCAACATCAGCCCATCGGACGAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54B3.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3093 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAAAATCTGTTTTGCAT. External right primer: CGTAATCGAGTCCGGAATGT. Internal left primer: CACCATCCCAAGCTTCAATC. Internal right primer: CGAAAAGTGTCTTTCCGGTT. Internal WT amplicon: 1152 bp. Deletion size: 391 bp. Deletion left flank: ATGCAGGAAGAAAGCCTCCGAAAACAAGAA. Deletion right flank: TCACTCCACTTGAAGTACTCAAACACCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1127.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1940 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAATGGATTGCCGAAGA. External right primer: GGGAAGTTCGTAATCGGTGA. Internal left primer: TTTCAGGCCAAATGTCCTTC. Internal right primer: CTGACAGCTCACACCACGAT. Internal WT amplicon: 2174 bp. Deletion size: 1250 bp. Deletion left flank: TGGAAGCATTCGTGAAGATTTGTCCGGCTT. Deletion right flank: CCTTCACGGTTGGCCCTGCTTTGAAGCTTG. Insertion Sequence: AGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21H12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3196 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGACTGCGAACATTGGGTAG. External right primer: CATACCGGGAGTCTGCTTTC. Internal left primer: CAAGACCGAGTGTCGACTGA. Internal right primer: TGGCCAGAAGTGATGTCTGA. Internal WT amplicon: 1140 bp. Deletion size: approximately 600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3252 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTATCTGTCGAAACGCGA. External right primer: CCTGAGAAAATGGGAAGCAA. Internal left primer: CGACGACCAGTTAATGCTGA. Internal right primer: TGATGACGTGGAAGAAGTGC. Internal WT amplicon: 1163 bp. Deletion size: 652 bp. Deletion left flank: GGTCGACGACCAGTTAATGCTGAAAAGAAT. Deletion right flank: TCGTTGTTCATTGTAGTGCTGGAATTGGTA. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK430.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3194 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATTTCAGGAGTTGCGGGAC. External right primer: GTCCCATTTCTCTCCGTTCA. Internal left primer: TGATACAGAATTCGCCAACG. Internal right primer: CATTCGGTCGCCTTATTGAT. Internal WT amplicon: 1374 bp. Deletion size: 812 bp. Deletion left flank: TCGAAAAGCTTCTTCTGGAACTTTCTCCGT. Deletion right flank: CTTATAGAAACTATTGAAGATGCTTCGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08B11.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1041 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCTCGATCGACACTTCGCT. External right primer: TAACATATCGACGTTGGGCA. Internal left primer: ACGGCTCGTCTGTTCTGATT. Internal right primer: AATTGACGGATCCACCTGAG. Internal WT amplicon: 2394 bp. Deletion size: 561 bp. Deletion left flank: GATCAATCTGAAATTCATTTTTCAAATTAT. Deletion right flank: TGCAAAATCGATTTCGTTCGGCAATCCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1248.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3390 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTCGTCGTTTTTCATC. External right primer: AGTGAATTTCGGTCAATCGG. Internal left primer: GCGCTCAGGATAATAGAACAA. Internal right primer: TTCTGTTTGAATTCCTCGCA. Internal WT amplicon: 1190 bp. Deletion size: 590 bp. Deletion left flank: ATTTTGGTTCCTTACTGTTTGTTAGAGCTT. Deletion right flank: GAAACCAGTAAGTGATAATTTCCTTTTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33G12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3435 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGTCCGATTTTGCAGCTTG. External right primer: TCCCCAGTGCTCTTTTATCG. Internal left primer: AACCATTTGATCATTGGCATT. Internal right primer: CCATGTGAAGTGGTTTTTGC. Internal WT amplicon: 1116 bp. Deletion size: 563 bp. Deletion left flank: AGGCTTTATCAGGTCTCCGTAAATCGATAG. Deletion right flank: GATTAACTCCGGCATTTGCTTTATAACGTG. Insertion Sequence: AC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05H5.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2875 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTCCACCAACGTAACACCA. External right primer: ACTCTTCTTGGCAGTGCGAT. Internal left primer: ATTCGGATCCACAGACTTCG. Internal right primer: AAGAGAACAAGCAAGACGGC. Internal WT amplicon: 1173 bp. Deletion size: 616 bp. Deletion left flank: ACATTCCAAAGTCAGCCATCTTGACGACTC. Deletion right flank: AGAAGTTTTTCCACCGATCTTCGCCGTCTT. Insertion Sequence: TCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3404 homozygotes (sterile with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GCCGAGATTTGGAGAAATGA. External right primer: AAGGCGCAGGACAACTACAT. Internal left primer: CAACAACATTCACAATCTTCATCA. Internal right primer: TGTGTGTCCTTTTCCCGTTT. Internal WT amplicon: 1124 bp. Deletion size: 643 bp. Deletion left flank: CTTAATTCCAGCTTCCTCAAGAGTTTGATT. Deletion right flank: TTTCTTTGTTGAAAGCGTCTTGGATCTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0495.7. Maternal effect lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3607 homozygotes (first-generation homozygotes viable and fertile, but F2 arrests as grotty L1 or L2). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACTCAGGATTGATCGCGT. External right primer: TTGGTGTGAATCGTCTCGAA. Internal left primer: ACACATTGGCTGATGGCATA. Internal right primer: CGTCCATCTGGATGTTTTGA. Internal WT amplicon: 1316 bp. Deletion size: 797 bp. Deletion left flank: GCAATGATAAGAAGCATTGTAATTACCATT. Deletion right flank: TCCCTTCTTCGGACCAATTCTCACAACGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E5.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok544 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21B10.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3438 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATCCTGAAGTCAATCGGT. External right primer: CAGCAACCTCTCCTTTCTCG. Internal left primer: TCCTCAAAGAAGCCGAGAAA. Internal right primer: AATGAACAAACCGATTCCCA. Internal WT amplicon: 1112 bp. Deletion size: 633 bp. Deletion left flank: AAGATTCTCATTGCCAACACACCAATGGAC. Deletion right flank: GACTCGGCTGAACTTGTCACAAGACTCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK945.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3447 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGTGATGATCGAGGAAGCAG. External right primer: TTCGTCTCTCCCGTAAATCG. Internal left primer: AAGCAGTTGCCGCATAACTT. Internal right primer: AACGGTTCTTCTGATTTCCG. Internal WT amplicon: 1263 bp. Deletion size: 409 bp. Deletion left flank: GAATTGTGCATAAACATGTTTCTGGTTTGT. Deletion right flank: ATTCACATCCAGCTCCTCGATCTTCAGCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32A5.7, F32A5.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3151 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GTTGGAGGTGCGGACATTAT. External right primer: ATGATCATCCACCAACGACC. Internal left primer: GGAATGTCGTTATTCGATTTTGA. Internal right primer: TTTCGAATTGTCTTTTCGCC. Internal WT amplicon: 1193 bp. Deletion size: 437 bp. Deletion left flank: ACCACCACGACCACGGGATTGCTCGCGCTG. Deletion right flank: AATATTCATCCACGAATCGCAGGCTTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk17 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C009H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2466 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 550 bp. Deletion left flank: TATACTTGTATGAGTGAAGAATTTGATGAT. Deletion right flank: TCATCCAGCGAACAAACCTTCCACCATCAC. Insertion Sequence: CCATCGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44F4.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3651 homozygotes (sterile giving unfertilized eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATAAGCCGGTGTGATACGG. External right primer: TCGATGTCTGATTGCAGCTC. Internal left primer: ATCGATTTGAAGCGAAGGC. Internal right primer: GTCAATTGAATCCGGAGCAT. Internal WT amplicon: 1211 bp. Deletion size: 555 bp. Deletion left flank: ATGGAATGATCCAAAACGAAGAGATTCATT. Deletion right flank: ACTGAACTTCCCCGGCTCAACAAGCAGTGA. Insertion Sequence: TCTCGAAGAGATTCATTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42A8.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- gk165 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26D10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3709 homozygotes (early- to mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCTTTCAATCCGAGACC. External right primer: ATTGGCGATCGAGTTTTGTC. Internal left primer: GGCAGAAACACCAACGATCT. Internal right primer: AAAAAGCCACGGAAAGTTGA. Internal WT amplicon: 1104 bp. Deletion size: 592 bp. Deletion left flank: TCCGAAGGCGTAGTATTTTCCGTCTTCTCC. Deletion right flank: CTTCCTTCCTTCTCTACACCTTCCGCGGGA. Insertion Sequence: CTTTTTTTCCTTTTTTTTCCGTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03C9.3. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and non-GFP ok511 homozygotes (Dpy animals that lay dead eggs). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53C12B.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1245 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGCTGCTAGTGGCCATGTTT. External right primer: GAAATGGGTGGGCACTTAAA. Internal left primer: GCTAACATCTTGCTTTGCCC. Internal right primer: CGCGTAGAATTAAACGGGAA. Internal WT amplicon: 3125 bp. Deletion size: 1458 bp. Deletion left flank: CAGTATGCGCATCAATGGAACATTCACAAT. Deletion right flank: TTTCTTGAGTTTCTGTTTCATGAATACTCA. Insertion Sequence: TTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28C6.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1220 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTCTTCCGAGTGAACTGGCT. External right primer: AGCACACATGCAGGTTGAAA. Internal left primer: CCATTTGAAGCAGCCAAGAT. Internal right primer: TACGATTTGAGGGGAGATCG. Internal WT amplicon: 2198 bp. Deletion size: 1785 bp. Deletion left flank: CTTTCTGTCGGAATTGCGAGCATCCCACGA. Deletion right flank: TTAAACTTATATTAAAGGCGCATGCCGTTT. Insertion Sequence: ACTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01F1.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3770 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCGATGATGTGCGAATTTGT. External right primer: CAATCGAACGCCTTGAAAAT. Internal left primer: CAAATCCATGATTTTCACTCCA. Internal right primer: AAGCTGAGCAATGGTTTTCTTT. Internal WT amplicon: 1241 bp. Deletion size: 653 bp. Deletion left flank: GGACGCTGGCATCAGCCGCACGGTTTTCAG. Deletion right flank: GGAACCACAGAGCAAGTTAATAAAGTTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G10.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3077 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGAATGCAAAACCTGAGAACAA. External right primer: TACAGCTGGATTTTCAACTGGAT. Internal left primer: ATACACCCGCTTTCCACAAG. Internal right primer: CCTCCAGCTTTCGATTTACG. Internal WT amplicon: 2029 bp. Deletion size: 368 bp. Deletion left flank: TTCGGTTACTCTTTGTTTTATATTTATTTT. Deletion right flank: TATTCAGTCTATGAAATACGATAAAGAAGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30B5.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3082 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGGTGTGTGCATAAGGA. External right primer: TTGATTGAATTGGCGATGAA. Internal left primer: GAGAGCTTCGGAAGACATGG. Internal right primer: TCCAGGTTCCCTGAAACAAG. Internal WT amplicon: 1567 bp. Deletion size: 390 bp. Deletion left flank: AAAATTTGAAAAAGGCTTTATATTAATGTT. Deletion right flank: TCGGATTCATGTTTTACTGCAAAATGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R53.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3079 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGTCCGTGAACGTTCTTGTT. External right primer: CAAAGAAAGCCAAGGTCGAG. Internal left primer: AAAATGTGTGCAGTTTTCAACG. Internal right primer: AACAACGACATCGTGTTCACTC. Internal WT amplicon: 1340 bp. Deletion size: 565 bp. Deletion left flank: TTATATCCTATTTTCTGCTTTAAATTTGAG. Deletion right flank: AATTTGAAACGTCAGATGGAACTCAAGTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3366 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCCATTTGAATCCTCGCTG. External right primer: AGCTTCCGATACAATGCCAC. Internal left primer: GTACCGGTGATTCGCTTTGT. Internal right primer: GAGCCGATCGTAAACCACAT. Internal WT amplicon: 1767 bp. Deletion size: 761 bp. Deletion left flank: TTACAAGATGGATTGAAGCATTTTTCAAGT. Deletion right flank: CGAATATCGGATGGATTGATTATTCGGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37B12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3365 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTTGCGTCAAAGTACGGT. External right primer: CCTATACACCTCTCATGCCTCC. Internal left primer: GGGTACCGTATTTTAGCGCA. Internal right primer: CCTGACGAATTGCCATCTTT. Internal WT amplicon: 2539 bp. Deletion size: 983 bp. Deletion left flank: GTGACAAGTTAAAGCGAATGGACCGAACAA. Deletion right flank: TGGAATTTAATAAAAATGTGTGGCTGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37B12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok436 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06F6.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1318 homozygotes (sterile, lays unfertilized oocytes and very few fertilized eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGCGATAAACGTCATTTCCT. External right primer: AACGTTTTTGCGTTCCAAAT. Internal left primer: TTGATTCCTTTTGCACCACA. Internal right primer: CTTCCGAAGCATGAAAAGGA. Internal WT amplicon: 3207 bp. Deletion size: 1673 bp. Deletion left flank: CAACCGACGCATATCGACTGTCAAGTCTCT. Deletion right flank: TTAATTCTCCACGTGTTTCTTTGAAATTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0495.2. Homozygous maternal-effect lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1202 homozygotes (viable F1s produce few F2s that arrest as early or mid-stage larvae). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATTATGAGCGACCACTTGGG. External right primer: CATTGAGGCAATTGAGAGCA. Internal left primer: GGACGACAGGAAAGATCTGG. Internal right primer: GGGTTTCACTTGCTCTGGTC. Internal WT amplicon: 2049 bp. Deletion size: 712 bp. Deletion left flank: GACAAATCGCCACACAAAAAGTCAAAACAT. Deletion right flank: GGAGAAAGAGAAAGAAGGATTTCCAATCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09A5.3. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok605 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0495.4. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54C9.8. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok464 homozygotes (probable embryonic arrest). Some heterozygotes appear to be sterile and even those with eggs seem to grow a bit slowly. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Recessive lethal. Nonsense allele identified by amplicon sequencing, balanced by inversion marked with dpy-10 and myo-2 GFP. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP gk3816 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain.

F44G4.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok604 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.7, F59G1.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok610 homozygotes (viable GFP- adult, sometimes slow-growing with various occasional body defects). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10B5.7. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok629 homozygotes (usually sterile adults, occasionally produce progeny). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05C12.10. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk32 homozygotes (early larval arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous lethal or sterile deletion balanced by mIn1. Deletion of 772 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous mIn1 is non-GFP fertile Dpy-10. Left flanking sequence: TTCTCTTCTATATATATATATTCTCCGTTT; Right flanking sequence: TAATTTGGTATCCACTGTATTTGTTGAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

T08H4.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- gk216 homozygotes (early larval arrest, Dpy). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53C12A.1. Homozygous lethal deletion balanced by GFP-marked balancer. Heterozygotes are WT with GFP signal in pharynx, and segregate WT GFP, Dpy bright GFP (mIn1 homozygotes) and non-GFP arrested early larvae (ok729 homozygotes). Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10G7.1. Homozygous lethal deletion balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk265 homozygotes (late larval arrest). Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807