Search Strains

Heterozygotes are WT and segregate WT, Dpy Uncs, and animals with muscle attachment defects and ventral cord displacement and detachment. Not well balanced. klf-3 was formerly known as mua-1.

Morphological changes in the rays, especially transformation of ray 6 into a thickened shape. Appearance of abnormal protuberances around rays. Closed structure of the fan. Impaired mating ability. Exons 8-10 of the adt-1 gene, encoding most of the metalloproteinase domain of ADT-1, are deleted in adt-1(cn30).

yIs2 [xol-1::laxZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion.

non-Unc, somewhat Dpy hermaphrodites. Gives DpyUncs when yDp16 is lost.

Heterozygotes are WT hermphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; yDf13 unc-1 dpy-3), WT males and Dpy males.

The hermaphrodites are variable in phenotype, but most are Dpyish (small) and sick. Pick these hermaphrodites to maintain the strain, since healthier animals may have picked up a suppressor mutation or gone polyploid, etc. Strain gives WT males.

WT hermaphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; unc-1 dpy-3), Unc hermaphrodites (yDp14; unc-1 dpy-3), DpyTra hermaphrodites (mnDp66/yDp14; yDf17), WT males, Unc males, and Dpy males. There are 2 types of WT hermaphrodites in this strain which are indistinguishable unless you score their offspring: mnDp66/yDp14; him-8; yDf17/unc-1 dpy-3 animals will have many WT males progeny; but mnDp66/yDp14; him-8; unc-1 dpy-3 animals will have primarily dpy male progeny [mnDp66/yDp14; unc-1 dpy-3 XO animals are mostly dead, but there are some escapers of lethality]. Maintain by picking L4 WT hermaphrodites and checking for correct segregation of progeny.

yIs34 [(pMN15.1) xol-1::GFP + rol-6(su1006)]. Pick Rollers. xol-1::GFP translational fusion with sXO-specific expression. Strain gives some non-Rollers, which represent silenced arrays.

yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion. Not all animals Roll.

mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Him. mIs10 suppresses recombination between unc-60 and dpy-11.

Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP Sterile homozygotes. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. May have him-8(e1489) in background, but unsure.

Lacks L-isoaspartyl methyltransferase (E.C. 2.1.1.77) activity.

wpEx146 [dat-1p::MYR::tdKillerRed + dat-1p::GFP]. Pick GFP+ to maintain. KillerRed expression in acetylcholine neurons. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpEx146 carries a tandem dimer version of KillerRed targeted to the plasma membrane through the addition of a myristoylation tag (mry-tdKillerRed). Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63.

Maintain at 20C or lower. Him. cec-4 cec-5 him-8 triple mutants exhibit partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. ok3124 deletion can be detceted by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj61 is a 444-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-5 (F32E10.6). The fj61 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.