Search Strains

More Fields
Strain Species Genotype Add
VC4275 C. elegans srz-4(gk5358[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1680 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTAGATATACCGCATGTTTGAACTCCTACT; Right flanking sequence: CGAAACCAGGTGCCTATATAATTCCAGTAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CHS1250 C. elegans srz-1(yum2552) V; srz-3(yum2553) srz-4(yum2554) I; srz-5(yum2555) srz-6(yum2556) II; srz-8(yum2557) srz-9(yum2558) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1136 C. elegans srz-42(yum1789) IV; srz-44(yum1790) srz-47(yum1791) srz-48(yum1792) srz-54(yum1793) V; srz-56(yum1794) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.