Search Strains

More Fields
Strain Species Genotype Add
RB1174 C. elegans W02H5.7(ok1216) V. Show Description
W02H5.7 Homozygous. Outer Left Sequence: gggatgggggatcagataat. Outer Right Sequence: aaatttgcatttgcctttgg. Inner Left Sequence: gttgctcactttatggggga. Inner Right Sequence: aatgccatgccatgtagtca. Inner Primer PCR Length: 2981. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
OP726 C. elegans unc-119(tm4063) III; wgIs726. Show Description
wgIs726 [sknr-1::TY1::EGFP::3xFLAG + rpn-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
VH7050 C. elegans sknr-1(hd7050[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2851 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGAGACCCGGCAAAGAAACAAAGATTATC; Right flanking sequence: GCATGGCATTTCATCAAGAACAAAGAGATA. sgRNA #1: AAGAAACAAAGATTATCGTG; sgRNA #2: TTGATCGTGACTACATGGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.