Search Strains

More Fields
Strain Species Genotype Add
LC74 C. elegans pah-1(ok687) II. Show Description
Superficially WT. Cuticle slightly more resistant to insult than WT. ES1-ES0. Severe cuticle abnormalities in double mutant with bli-3(e767).
RB857 C. elegans pah-1(ok687) II. Show Description
K08F8.4. Homozygous. Outer Left Sequence:TCCAACGACGGTGAACACTA. Outer Right Sequence: CTCGTCACAAGGCAGTCGTA. Inner Left Sequence: CGTCTGTAAATCGAGCAGCA. Inner Right Sequence: GAAGTACGCCATGGAATCGT. Inner primer WT PCR product: 2344. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
PHX3596 C. elegans tph-1(mg280) pah-1(syb3596) II. Show Description
Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX3601 C elegans pah-1(syb3601) II. Show Description
Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX3634 C elegans pah-1(syb3634[GFP::H2B::T2A::pah-1]) II. Show Description
Superficially wild-type. GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
PHX3678 C elegans tph-1(mg280) pah-1(syb3678[GFP::H2B::T2A::pah-1]) II. Show Description
GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.