Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
OH4974 C. elegans otIs114 I; lsy-12(ot89) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers.
OH15227 C. elegans unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID*]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID* (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID* cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, et al. Curr Biol. 2018 Sep 10;28(17):2813-2823.e2. doi: 10.1016/j.cub.2018.06.045. Epub 2018 Aug 23. PMID: 30146154.