| RM2710 |
C. elegans |
snf-11(ok156) V. Show Description
Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
|
|
| RM2711 |
C. elegans |
unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
|
|
| RM2717 |
C. elegans |
snf-3(ok293) II; unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially the same as unc-25 mutants (Shrinker, Exp, etc.). Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 and unc-25; snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
|
|
| RM2718 |
C. elegans |
snf-3(ok293) II; snf-11(ok156) V. Show Description
Superficially wild-type. Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
|
|
| RB1375 |
C. elegans |
C44H4.6(ok1560) X. Show Description
C44H4.6 Homozygous. Outer Left Sequence: catctgtttgcggactttga. Outer Right Sequence: ctctgtgcatgtttgcgttt. Inner Left Sequence: ctttgtcgccttcctcactc. Inner Right Sequence: caatggctaggatcccaaaa. Inner Primer PCR Length: 2778. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1376 |
C. elegans |
rab-33&taf-11.3(ok1561) III. Show Description
F43D9.5, F43D9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1377 |
C. elegans |
acs-17(ok1562) X. Show Description
C46F4.2 Homozygous. Outer Left Sequence: ggtcgattcttcgatttcca. Outer Right Sequence: tggggagcataggtttttca. Inner Left Sequence: cctaaaacatatggccaccg. Inner Right Sequence: tgaacgcacggtatgtttgt. Inner Primer PCR Length: 3216. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1379 |
C. elegans |
F11C7.1(ok1564) X. Show Description
F11C7.1 Homozygous. Outer Left Sequence: gcaaacgccaataactggat. Outer Right Sequence: atgtgaaagcctacgccaac. Inner Left Sequence: tgcctgatctctcattgtgc. Inner Right Sequence: atccaattcggtggactcag. Inner Primer PCR Length: 3214. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1380 |
C. elegans |
C11D2.2(ok1565) IV. Show Description
C11D2.2 Homozygous. Outer Left Sequence: aggccgattgcattgataag. Outer Right Sequence: ggggcaattttcaacaaaaa. Inner Left Sequence: ggtttgatcgacttgttggg. Inner Right Sequence: cccgatccgtttattcttga. Inner Primer PCR Length:3169. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1381 |
C. elegans |
F52B5.1(ok1566) I. Show Description
F52B5.1 Homozygous. Outer Left Sequence: agtggggaaggctttcaaat. Outer Right Sequence: ctattggccccaattgtcac. Inner Left Sequence: gacaaagaggcggagtgaag. Inner Right Sequence: ccgattctgggttcatgtct. Inner Primer PCR Length: 3124. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1382 |
C. elegans |
C08G5.5(ok1567) II. Show Description
C08G5.5 Homozygous. Outer Left Sequence: attgggggattttccaagac. Outer Right Sequence: actagttttgggcatggtgc. Inner Left Sequence: ccgcgagcaaaatacctaaa. Inner Right Sequence: gctttaagcttcggctgttg. Inner Primer PCR Length: 2200. Estimated Deletion Size: about 750 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1383 |
C. elegans |
C47E8.8(ok1568) V. Show Description
C47E8.8 Homozygous. Outer Left Sequence: cgtctggcaaaacttttcgt. Outer Right Sequence: atcattcgctcgagttctgg. Inner Left Sequence: aaaatcattccgatgatgcc. Inner Right Sequence: tcagcttcttcctggtcgat. Inner Primer PCR Length: 3215. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB1384 |
C. elegans |
dod-21&C32H11.11(ok1569) IV. Show Description
C32H11.10, C32H11.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|