| BC10471 |
C. elegans |
dpy-5(e907) I; sEx10471. Show Description
sEx10471 [rCes F40F9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| RB957 |
C. elegans |
F40F9.1(ok852). Show Description
F40F9.1. Homozygous. Outer Left Sequence: TCCAAAGCCTTGGTCAGTTT. Outer Right Sequence: ATCGATGAAGTCGGGTGAAG. Inner Left Sequence: TTGCGAAATCACACGTCTTC. Inner Right Sequence: CTTCCTTCGACAAGACAGCC. Inner Primer WT PCR product: 2691. Deletion size: 1720 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| BC11611 |
C. elegans |
dpy-5(e907) I; sEx11611. Show Description
sEx11611 [rCes F40F9.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| RG3358 |
C. elegans |
F40F9.10(ve858[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1891 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCACCATATCTTATCATATTGACAACCG ; Right flanking sequence: CCATTGAGGTTAAAAGAAGAACGAAGTCCG. F40F9.10 sgRNA #1: TGATCTCATGTATTCAGTGA; F40F9.10 sgRNA #2: AGAGAACGTCCAGTTTACGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|