Laboratory Information

NameZT View on WormBase
Allele designationfj
HeadTabara, Hiroaki
InstitutionTWMU, Japan
Address Loft-Hills 102
157 Benten-cho
Shinjuku 162-0851
Japan
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
ZT2 drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.
ZT3 csr-1(fj54) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+. csr-1 homozygotes are basically sterile, but some of them occasionally lay a small number of dead eggs. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. Homozygous nT1[qIs51] inviable.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
fj52 Allele deletion
fj54 Allele deletion