Laboratory Information

NameZT View on WormBase
Allele designationfj
HeadTabara, Hiroaki
InstitutionNational Institute of Genetics, Mishima, Japan
Address Advanced Genomics Center
Kohara Group
Yata 1111
Mishima 411-8540
Japan
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
ZT2 drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.
ZT3 csr-1(fj54) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
fj52 Allele deletion
fj54 Allele deletion