Laboratory Information
| Name | ZT View on WormBase |
|---|---|
| Allele designation | fj |
| Head | Hiroaki Tabara |
| Institution | Tohoku University, Sendai, Japan |
| Address | Graduate School of Life Sciences Laboratory of Developmental Dynamics 2-1-1 Katahira Aoba-ku, Sendai 980-8577 Japan |
| Gene classes |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| ZT2 | drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable. |
| ZT3 | csr-1(fj54) IV/nT1 [qIs51] (IV;V). | C. elegans | Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| fj52 | Allele | deletion | |
| fj54 | Allele | deletion |