Gene Information: mir-795

Namemir-795 View on WormBase
Species C. elegans
SequenceF33E2.9
Genetic positionI:13.66 +/- 0.012 cM
Genomic positionI: 12594569..12594657

Strains carrying this gene

Strain Genotype Description
VT3299 mir-795(ma298) I; maIs105 V. maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11].
VT3301 mir-794 mir-795(maDf5) I. mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11].