Variation Information: ma298
| Name | ma298 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | I:13.66 +/- 0.012 cM |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | protein change unknown or not listed |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| VT3299 | mir-795(ma298) I; maIs105 V. | C. elegans | maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11]. |