Variation Information: ma298
Name | ma298 View on WormBase |
---|---|
Species | C. elegans |
Genetic position | I:13.66 +/- 0.012 cM |
Genomic position | genomic coordinates unknown or not listed |
Protein change | protein change unknown or not listed |
Strains carrying this variation
Strain | Genotype | Species | Description |
---|---|---|---|
VT3299 | mir-795(ma298) I; maIs105 V. | C. elegans | maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11]. |