| VT1064 |
mir-48(n4097) maIs105 V; mir-84(n4037) X. |
C. elegans |
maIs105 [col-19::GFP]. Retarded heterochronic phenotype. Worms exhibit supernumerary adult-stage molt and are often unable to exit the molt, becoming trapped in the cuticle. col-19::GFP expression is reduced in hyp7 at the L4 molt. n4037 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395. |
| VT3297 |
maIs105 V; mir-793(ma292) X. |
C. elegans |
maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11]. |
| VT3299 |
mir-795(ma298) I; maIs105 V. |
C. elegans |
maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11]. |
| VT3593 |
lin-46(ma385) maIs105 V. |
C. elegans |
maIs105 [col-19::GFP]. Retarded heterochronic phenotypes: extra seam cells and alae gaps in young adults. ma385 is a 1681 bp deletion of the lin-46 gene. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21). |
| VT3751 |
maIs105 V; hbl-1(ma430[hbl-1::mScarlet-I]) X. |
C. elegans |
maIs105 [col-19::GFP] V. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Curr Biol. 2019 Jun 3;29(11):1735-1745.e4. |
| VT3855 |
lin-46(ma467) maIs105 V. |
C. elegans |
maIs105 [col-19::GFP]. Precocious heterochronic phenotypes: fewer seam cells and protruding vulva in young adults and patches of alae in L4 larvae. ma467 is a 12 bp deletion in the 5'UTR of the lin-46 gene, which results in gain-of-function of lin-46. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21). |
| VT3923 |
maIs105 V; daf-12(ma498[daf-12::mScarlet-I]) X. |
C. elegans |
maIs105 [col-19p::GFP] V. mScarlet-I tag inserted at C-terminus of endogenous daf-12 locus through CRISPR/Cas9-engineering. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111. |