Gene Information: glb-31

Nameglb-31 View on WormBase
Species C. elegans
SequenceY57G7A.9
Genetic positionII:-15.52 +/- 0.003 cM
Genomic positionII: 1300064..1301654

Strains carrying this gene

Strain Genotype Description
VC4085 glb-31(gk5173) II. Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5173 mutation is G->A, flanking sequences ATATGTAAAAACTCACCTCTTGGAAGTACT and ATCGTTTCCATTGATATGATCCATCCAGAC.