Variation Information: gk5173

Namegk5173 View on WormBase
Species C. elegans
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
VC4085 glb-31(gk5173) II. C. elegans Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5173 mutation is G->A, flanking sequences ATATGTAAAAACTCACCTCTTGGAAGTACT and ATCGTTTCCATTGATATGATCCATCCAGAC.