| DA596 |
snt-1(ad596) II. |
Eat mutant. Strong Unc Eat. Jerky backward Unc. Hypomorph. |
| DA778 |
dpy-10(e128) snt-1(ad596) II. |
|
| MT6977 |
snt-1(n2665) II. |
Jerky Coiler. Eat-slow pharyngeal pumping. |
| MT8191 |
snt-1(md290) unc-104(e1265) II/mnC1 [dpy-10(e128) unc-52(e444)] II. |
Heterozygotes are WT and segregate WT, Unc, and paralyzed Dpy Uncs. Reference: Jorgensen EM, Nature. 1995 Nov 9;378(6553):196-9. |
| NM204 |
snt-1(md290) II. |
snt-1 encodes the C. elegans homolog of synaptotagmin I. md290 is a deletion that removes most of the coding sequence. Strain is a slow growing aldicarb resistant (Ric) Unc. Males won't mate. |
| RM1613 |
snt-1(md290) II. |
snt-1(md290) is a 3264-bp deletion removing all coding sequence in exons 3-8. Breakpoints: ttatagatttcaattaaatagtaaacaaaa / / aatctctctttgttttcactcttccaacat. Reference: Nonet ML, et al. Cell. 1993 Jul 2;73(7):1291-305. |
| RM1620 |
snt-1(md220) II. |
snt-1(md220) is a 9-bp deletion in exon 5 removing V312-L314. Breakpoints: ggtacgtcccaactgctggtaaattgacag / / tggaagcaaaaaatcttaagaaaatggacg. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52. |
| RM1625 |
snt-1(md259) II. |
snt-1(md259) is a 2-bp deletion in exon 6A. Breakpoints: tttcattttctggggtaattttcagatcct / / tgtgaagattgtgttgatgcaaggtggaaa. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52. |
| RM3054 |
snt-1(md290) II; mdIs126; mdIs129. |
mdIs126 [snt-1p::snt-1(genomic; B-stop)::CFP]. mdIs129 [snt-1p::snt-1(genomic; A-stop)::YFP]. snt-1 mutation in genome is rescued by 2 integrated transgenes. snt-1(genomic; B-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6B; also referred to as "snt-1(A only)." snt-1(genomic; A-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6A; also referred to as "snt-1(B only)." Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52. |
| RM3286 |
snt-1(md290) II; unc-41(e268) V. |
Unc. |
| RM3657 |
snt-1(md290) II; unc-41(md152) V. |
Very uncoordinated and slow growing. |