Gene Information: unc-34

Nameunc-34 View on WormBase
Species C. elegans
SequenceY50D4C.1
Genetic positionV:-19.88 +/- 0.017 cM
Genomic positionV: 982706..996914

Strains carrying this gene

Strain Genotype Description
CB315 unc-34(e315) V. Unc. Male spicules abnormal. Recessive. M-MATING-NO SUCCESS.
CB566 unc-34(e566) V. Unc.
JK1219 unc-34(e315) lag-2(q387) V/nT1 [unc-?(n754) let-?] (IV;V). Heterozygotes are Unc. [Note from Kimble lab: Min Han did a complementation test on this strain and found that unc-34(e315) is lost from this strain.] Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
KX10 ife-3(ok191)/unc-34(e566) V. At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
LE983 unc-34(lq17) V.
MT4446 unc-34(e566) unc-60(e677) dpy-11(e224) V. Dpy. Unc.
MT6185 dpy-1(e1) III; unc-34(e566) V. Mapping strain. Unc is ts.
OX977 unc-34(gm104) V. Unc. According to Withee (2004), gm104 has been sequenced and introdices an early amber stop at W24. Reference: Withee J, et al. Genetics. 2004 Jul;167(3):1165-76. PMID: 15280232
QP218 unc-34(e315) dpy-11(e224) rol-9(sc148) V. Unc. Dpy. Rol(ts).