Caenorhabditis Genetics Center (CGC)

Variation Information: e566

Namee566 View on WormBase
Species C. elegans
Genetic positionV:-19.88 +/- 0.017 cM
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
CB566 unc-34(e566) V. C. elegans Unc.
KX10 ife-3(ok191)/unc-34(e566) V. C. elegans At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
MT4446 unc-34(e566) unc-60(e677) dpy-11(e224) V. C. elegans Dpy. Unc.
MT6185 dpy-1(e1) III; unc-34(e566) V. C. elegans Mapping strain. Unc is ts.