Laboratory Information
| Name | KX View on WormBase |
|---|---|
| Allele designation | eu |
| Head | Brett D Keiper |
| Institution | East Carolina University, Greenville, NC |
| Address | 600 Moye Blvd East Carolina Univeristy Brody 52-28 Greenville 27834 United States |
| Website | http://www.ecu.edu/cs-dhs/biochemistry/Faculty-Keiper.cfm |
| Gene classes | ifg |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| KX10 | ife-3(ok191)/unc-34(e566) V. | C. elegans | At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform. |
| KX110 | ced-9(n1653) mab-5(mu14) III; bcIs39 V. | C. elegans | bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V. Temperature sensitive induction of germ cell apoptosis at 25 C. Large number of germ cells are decorated by CED-1::GFP within 48 h. Activates CED-3-mediated cleavage of IFG-1, visualized by western blot (Contreras, V., et al, 2011). |
| KX15 | ife-2(ok306) X. | C. elegans | No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2). |
| KX155 | ife-1(eu20[mKate2:Myc3x:ife-1]) III, ife-3(eu21[GFP::Flag3x::ife-3]) V | C. elegans | In-frame CRISPR/Cas9 fusions into the genes encoding the eIF4E paralogs IFE-1 and IFE-3. Red and Green fluorescence, respectively. Strong fluorescence for both in the hermaphrodite and male gonads, but with distinct expression character and germ granule association. Germ cell cytoplasmic expression and lesser somatic expression are also observed. Both insertions are homozygous by PCR confirmation. |
| KX17 | ife-4(ok320) X. | C. elegans | C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4). |
| KX38 | ifg-1(ok1211)/mIn1 [mIs14 dpy-10(e128)] II. | C. elegans | Heterozygotes are WT and GFP+. ok1211 homozygotes arrest at L2 stage. mIn1 animals are Dpy and GFP+. |
| KX54 | ifg-1(cxTi9279) II; bcIs39 V. | C. elegans | bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V. Temperature-sensitive germ cell apoptosis leading to infertility at 25 C. Apoptosing germ cells are decorated by CED-1::GFP in the gonad. Loss of p170 form of IFG-1 (but not p130 IFG-1) confirmed by Western blot. Escaping eggs are fertilized and embryonic lethal. Mos-1 transposon insertion previously described as ifg-1::mos-1(cxP9279) II; confirmed by triple primer PCR with 5’-ACCAAACTGGGCAAACAAAG-3’, 5’-GCTCAATTCGCGCCAAACTATG-3’, and 5’-CTTCCTGAAATTTGGTTTAACAGT-3’. Homozygous ifg-1::mos yields only 444 bp product. Outcrossed heterozygotes yield both 353 bp (wild type ifg-1) and 444 bp products. |
| KX80 | ife-5(ok1934) II. | C. elegans | |
| KX84 | ced-3(n2452) IV; bcIs39 V. | C. elegans | bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V. Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. ced-3 deletion confirmed by genomic triple primer PCR with 5’-AGTTCACCGTGACAGCGTCTCTTC-3’, 5’-CGATTACGACTTGAACTGTATCCGA-3’, and 5’-TCTTGTGTAAACGAGATTTGCAATG-3’. Homozygous ced-3(n2452) yields only 1,110 bp product. Outcrossed heterozygotes yield both 1,411 bp (wild type ced-3) and 1,110 bp products. [NOTE: (11-05-2019) A user has reported this strain exhibits temperature-sensitive sterility when raised at 25C.] |
| KX89 | ced-4(n1162) III; bcIs39 V. | C. elegans | bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V. Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. Genetically identical to KX87 (Contreras, V., et al, 2011). |
| SS712 | ife-1(bn127) III. | C. elegans | Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt//tgatgaaaattaattgtatt. The ife-1 gene is the third in an operon, but the deletion is contained completely within the ife-1 gene. |
This laboratory hasn't submitted any alleles to the CGC.