Laboratory Information
| Name | BX View on WormBase |
|---|---|
| Allele designation | wa |
| Head | Jennifer L. Watts |
| Institution | Washington State University, Pullman WA |
| Address | School of Molecular Biosciences PO Box 647520 Pullman 99164-7520 United States |
| Gene classes | cytb elo valv |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| BX10 | ads-1(wa3) III. | C. elegans | Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75. |
| BX106 | fat-6(tm331) IV. | C. elegans | Received new stock with confirmed deletion from Jennifer Watts 07/16/2009. |
| BX107 | fat-5(tm420) V. | C. elegans | Received new stock with confirmed deletion from Jennifer Watts 07/16/2009. |
| BX110 | fat-6(tm331) IV; fat-5(tm420) V. | C. elegans | |
| BX113 | lin-15B&lin-15A(n765) X; waEx15. | C. elegans | waEx15 [fat-7::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+. |
| BX115 | lin-15B&lin-15A(n765) X; waEx16. | C. elegans | waEx16 [fat-6::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+. |
| BX14 | elo-1(wa7) IV. | C. elegans | Reduced fatty acid elongation. |
| BX150 | lin-15B&lin-15A(n765) X; waEx18. | C. elegans | waEx18 [fat-5::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+. |
| BX153 | fat-7(wa36) V. | C. elegans | |
| BX156 | fat-6(tm331) IV; fat-7(wa36) V. | C. elegans | |
| BX160 | fat-7(wa36) fat-5(tm420) V. | C. elegans | |
| BX165 | nhr-80(tm1011) III. | C. elegans | |
| BX17 | fat-4(wa14) IV. | C. elegans | No delta5 fatty acid desaturase activity. |
| BX24 | fat-1(wa9) IV. | C. elegans | No N3 fatty acid desaturase activity. |
| BX259 | acl-7(wa20) II. | C. elegans | Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75. |
| BX26 | fat-2(wa17) IV. | C. elegans | No delta 12 fatty acid desaturase activity. Slow growing. Unc. Dpy. Cold sensitive - maintain at 20C or higher. |
| BX275 | fard-1(wa28) X. | C. elegans | Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75. |
| BX30 | fat-3(wa22) IV. | C. elegans | Slow growing. Unc. Dpy. No delta6 fatty acid desaturase activity. |
| BX52 | fat-4(wa14) fat-1(wa9) IV. | C. elegans | |
| CE541 | sbp-1(ep79) III. | C. elegans | Slow growth, low fat stores. Viable at 15C, not at 25C. Slightly Dpy, reduced brood size, low penetrance. Maintain under normal conditions. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Liang et al., (2010) PlosOne 5:3 e9869. |
| IG1839 | frSi17 II; frIs7 IV; rde-1(ne300) V. | C. elegans | frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454 |
| IG1846 | frSi21 II; frIs7 IV; rde-1(ne300) V. | C. elegans | frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454 |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| wa7 | Allele | deletion | |
| wa36 | Allele | substitution | nonsense |
| wa14 | Allele | substitution | nonsense |
| wa9 | Allele | substitution | nonsense |
| wa17 | Allele | substitution | |
| wa22 | Allele | substitution |