Variation Information: ox199
| Name | ox199 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | X:1.73 +/- 0.000 cM |
| Genomic position | X: 9946066..9946066 |
| Protein change | Substitution |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| EG199 | nas-37(ox199) X. | C. elegans | At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA. |