| EG199 |
nas-37(ox199) X. |
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA. |
| EG3283 |
nas-37(tm410) X. |
At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga. |
| VC2608 |
nas-37(ok3384) X. |
C17G1.6. External left primer: GGCAGTTTGTCTTTTCACCC. External right primer: CAGAAGACATCGACAGGCAA. Internal left primer: TCTTGTGCTTGATGAGAGGAA. Internal right primer: CGTTCCGAAGGAGATGATGT. Internal WT amplicon: 1326 bp. Deletion size: 484 bp. Deletion left flank: GAATCTTTCTGTTGGTGGATGAACTTCCAA. Deletion right flank: GCTGTATCTGGAGCAACTGTCGTCGTCGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |