| NJL3729 |
nicTi600[*oxTi556] I; unc-119(ed3) III. |
nicTi600 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi556]] I. Maintain at 20C, somewhat sick at 25C. Unc. nicTi600 is a modified version of oxTi556 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted). |
| NJL3730 |
nicTi601[*oxTi726] II; unc-119(ed3) III. |
nicTi601 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi726]] II. Maintain at 20C, somewhat sick at 25C. Unc. nicTi601 is a modified version of oxTi726 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted). |
| NJL4308 |
nicTi605[*oxTi612] unc-119(ed3) III. |
nicTi605 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi612]] III. Broad, nuclear red fluorescence. Unc. Maintain at 20C, somewhat sick at 25C. Unc. nicTi605 is a modified version of oxTi612 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted). |
| NJL3878 |
unc-119(ed3) III; nicTi603[*oxTi705] IV. |
nicTi603 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi705]] IV. Maintain at 20C, somewhat sick at 25C. Unc. nicTi603 is a modified version of oxTi705 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted). |
| NJL4309 |
unc-119(ed3) III; nicTi606[*oxTi391] IV. |
nicTi606 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi391]] IV. Maintain at 20C, somewhat sick at 25C. Unc. nicTiX606 is a modified version of oxTi391 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted). |
| NJL3731 |
unc-119(ed3) III; nicTi602[*oxTi392] V. |
nicTi602 [eft-3p::tdTomato::H2B::unc-119(-)[*oxTi392]] V. Maintain at 20C, somewhat sick at 25C. Unc. nicTi602 is a modified version of oxTi392 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted). |
| NJL3879 |
unc-119(ed3) III; nicTi604[*oxTi400] X. |
nicTi604[eft-3p::tdTomato::H2B::unc-119(-) [*oxTi400]] X. Maintain at 20C, somewhat sick at 25C. Unc. nicTi604 is a modified version of oxTi400 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted). |
| EAG16 |
eagIs6[*fxIs10] II. |
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653. |
| EAG25 |
eagIs6[*fxIs10] ujIs113 II. |
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653. |
| EAG28 |
eagIs6[*fxIs10] II; ltIs44 IV. |
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653. |
| XIL9106 |
bar-1(thu106[bar-1::2A::H1::mCherry]) X. |
2A::H1::mCherry was inserted at the 3' end of the endogenous bar-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9119 |
sup-37(thu119[sup-37::2A::H1::mCherry]) V. |
2A::H1::mCherry was inserted at the 3' end of the endogenous sup-37 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9122 |
ztf-14(thu120[ztf-14::2A::H1::mCherry]) X. |
2A::H1::mCherry was inserted at the 3' end of the endogenous ztf-14 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9164 |
daf-3(thu164[daf-3::SL2::mCherry::H2B]) X. |
SL2::mCherry::H2B was inserted at the 3' end of the endogenous daf-3 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9127 |
nhr-67(thu127[nhr-67::LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP]) IV. |
LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP was inserted at the 3' end of the endogenous nhr-67 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9129 |
nhr-34(thu129[nhr-34::H1::mCherry]) IV. |
H1::mCherry was inserted at the 3' end of the endogenous nhr-34 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9115 |
Y56A3A.18(thu115[Y56A3A.18::2A::H1::mCherry]) III. |
2A::H1::mCherry was inserted at the 3' end of the endogenous Y56A3A.18 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9136 |
ztf-7(thu136[ztf-7::2A::H1::mCherry]) V. |
2A::H1::mCherry was inserted at the 3' end of the endogenous ztf-7 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| JK5800 |
qSi364 IV. |
qSi364 [3xFLAG::fbf-2(R7/R8 loop deletion) + unc-119(+)] IV. Single-copy MosSCI insertion into oxTi177 IV. R7/R8 loop deletion removes a critical protein-to-protein interface. qSi364 is phenotypically wild-type on its own, but Mog when crossed into fbf-1(ok91) fbf-2(q704) background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK5810 |
fbf-2(q945[3xFLAG::fbf-2]) II. |
3xFLAG tag inserted at N-terminus of endogenous fbf-2 locus. Generated in N2 background. Reference: Ferdous AS, et al. 2023 May 1;150(9):dev201705. doi: 10.1242/dev.201705. PMID: 37070766. |
| JK5935 |
fbf-1(ok91) fbf-2(q973[3xFLAG::fbf-2]) II. |
3xFLAG tag inserted at N-terminus of endogenous fbf-2 locus in fbf-1 null background (parental strain JK3022). Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK5984 |
fbf-2(q1011[*q945]) II. |
q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK5986 |
fbf-1(ok91) fbf-2(q1023[*q973])/mIn1[mIs14 dpy-10(e128)] II. |
q1023 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5935 fbf-2(q945[3xFLAG::fbf-2]) II. Pick GFP+ t maintain. Homozygous sterile (Mog) mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok91 q1023 homozygotes (sterile Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK6410 |
fbf-2(q1078[*q945]) II. |
q1078 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK6412 |
fbf-2(q1080[*1011]) II. |
q1080 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2 with a Y479A point mutation in the R7/R8 loop. Derived by modification of parental strain JK5984 fbf-2(q1011[*q945]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK6526 |
let-711(q1238[let-711::3xV5]) III. |
GSS linker and 3xV5 tag inserted at C-teminus of endogenous let-711 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK6540 |
gld-1(q1242) I. |
q1242 is an engineered TGT to ACA substitution in FBEa1 of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK6563 |
daz-1(q1254[1xV5::daz-1]) II. |
1xV5 tag inserted at N-teminus of endogenous daz-1 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK6568 |
gld-1(q1257) I. |
q1257 is an engineered TGT to ACA substitution in FBEb of the endogenous gld-1 locus. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK6594 |
ife-3(q1259[1xV5::ife-3]) V. |
1xV5 tag inserted at N-teminus of endogenous ife-3 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| JK6602 |
gld-1(q1271[*q1242]) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
Engineered TGT to ACA substitutions in FBEa1 and FBEb of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP q1271 homozygotes (sterile Mog). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by modification of gld-1(q1242) homozygotes from parental strain JK6540. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520. |
| RG3446 |
Y49E10.27(ve946[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCAGTTCTGAGGGGTTTTTTCAATATCCG ; Right flanking sequence: aggcacagatttctcaattgatttcgcatg. Y49E10.27 sgRNA A: CATAAATGAACGAACACCGC; Y49E10.27 sgRNA B: ctacaaaaaatgcggagacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3448 |
otub-1(ve948[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTTTCTTCTCTAAAAATTAAACATTTT ; Right flanking sequence: GATGTGCTCTCTCTTTCTCATCACCACTCC. otub-1 sgRNA A: CTTACAGGTAACAGGAACTA; otub-1 sgRNA B: GGGAGAGAAGACAAGAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3410 |
phf-34(ve910[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Homozygous viable. Deletion of 2012 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTAACTATGAGAAATTATACTAAAATACAG ; Right flanking sequence: ATAGCAATCGAAATCACTATAAACTATTTA. phf-34 sgRNA A: ACAAACGTAGAGTGTAACGA; phf-34 sgRNA B: CGATTTTACACAGTTCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3416 |
prx-2(ve916[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. ve916 homozygotes are thin, slow-growing, lay small, slow-growing broods. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow growing hermaphrodites that can be maintained as a homozygous slow growing population (ve916 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Deletion of 1288 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTTCCCAATAATACACTACACTGTACCCT; Right flanking sequence: TGGTCATTCTACAATAACTGAAAGCATTTT. prx-2 sgRNA A: AGGAATAGTGATAGTGGGGG; prx-2 sgRNA B: CTCTATTTCCTTCGATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3453 |
madf-1(ve953[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 1324 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTGACAATTGTCTCTTCAAGGCTATTCGA ; Right flanking sequence: TGGATTTAGATTATTTTCAACTTTTTCGGT. madf-1 sgRNA A: ATCGGCTTCTTTTAATTCGG; madf-1 sgRNA B: GAAATTAAATTTTAATCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3440 |
rnp-7(ve940[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. |
qIs26 [lag-2::GFP + rol-6(su1006)] III. Maintain by picking GFP+ Rollers (GFP expression in both pharynx and distal tip cells). Heterozygotes are Rol GFP+ (GFP expression in both pharynx and distal tip cells), and segregate Rol GFP+ (GFP expression in both pharynx and distal tip cells), non-Rol GFP+ (GFP only in pharynx) ve940 homozygotes (Unc, arrest as larvae with a curled tail). qC1[qIs26] is homozygous lethal (unknown stage). Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCTTCGATATCCACCACCGGATCCTCCA; Right flanking sequence: TGGAAGATATTGCACTGGTGGTCGTGCTTC. rnp-7 sgRNA A: GGAAGCCGATACAGTACAGG; rnp-7 sgRNA B: ACTAGTAGGTCCTGGCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3439 |
deb-1(ve939[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. Deletion of 7456 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead embryos (ve939 homozygotes; embryonic lethal), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Left flanking Sequence: CCATCAGAATGGCCATTCTCTTCGCAGCCG; Right flanking sequence: ttgtaagatttgtacagatttttcgagctt. deb-1 sgRNA A: ACAGGAGAACGATATTGTGG; deb-1 sgRNA B: accatccataagtctcaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| COP2331 |
spin-1(knu1010[spin-1::mCherry::loxP::HygR::loxP]) V. |
mCherry tag inserted at the C-terminus of the endogenous spin-1 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
| COP2341 |
spin-2(knu1018[spin-2::mCherry::loxP::HygR::loxP]) IV. |
mCherry tag inserted at the C-terminus of the endogenous spin-2 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
| COP2343 |
spin-3(knu1020[spin-3::mCherry::loxP::HygR::loxP]) X. |
mCherry tag inserted at the C-terminus of the endogenous spin-3 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
| KAB72 |
spin-2(ok2121) IV; spin-1(ok2087) V; spin-3(ok2286) X. |
Triple mutant of the three spinster paralogs expressed exclusively in somatic tissues. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
| KAB111 |
louIs7. |
louIs7 [ges-1p::sqst-1::mCherry::GFP::unc-54 3'UTR]. Tandemly-tagged p62/sequestosome marker expressed in the gut can be used to monitor autophagic activity. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
| KAB122 |
louIs8. |
louIs8 [ges-1p::nuc-1::mCherry::unc-54 3'UTR]. mCherry-tagged lysosomal nuclease NUC-1 expression can be used to monitor lysosomes in the gut. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
| KAB157 |
louIs10. |
louIs10 [myo-3p::sqst-1::mCherry::GFP::unc-54 3'UTR]. Tandemly-tagged p62/sequestosome marker expressed in the muscle can be used to monitor autophagic activity. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
| COP2416 |
spin-4(knu1071[spin-4::mCherry]) Ill. |
mCherry tag inserted at the C-terminus of the endogenous spin-4 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
| COP2456 |
spin-4(knu1099) Ill. |
knu1099 is an engineered 7437 bp deletion in spin-4. Flanking sequences immediately outside of the region deleted ares: 5′ flank (forward strand), 5′- GTT CGG TGG AGC GCG CCT GCG -3’; 3′ flank (reverse strand), 5′- GTC TGT GTT GCT GTT CCT CAT -3’. In between these flanking sequences, a three-frame stop as well as a unique primer-binding sequence were inserted in place of the deleted sequence. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Flora Y & Bohnert KA. Dev Biol. 2023 Dec:504:137-148. doi: 10.1016/j.ydbio.2023.09.013. PMID: 37805103. |
| SHX324 |
fzo-1(zju136[fzo-1::GFP]) II. |
GFP tag inserted into endogenous fzo-1 locus via CRISPR/Cas9 engineering. Reference: Fu H, et al. Nat Commun. 2020 Feb 26;11(1):1050. PMID: 32103012. |
| AML105 |
wtfIs32. |
wtfIs32 [str-2p::ChR2(H134R)::GFP +, myo-3p:mCherry]. Expression of an activating opsin molecule ChR2 (H134R) in AWC-ON neuron and mCherry in body wall muscles. Reference: Chen KS, et al. Olfactory learning alters navigation strategies and behavioral variability in C. elegans. ArXiv, Feb 23:arXiv:2311.07117v2. PMID: 38013890. |
| AML177 |
wtfIs145. |
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3'UTR + pha-1(+)]. Pan-neuronal expression of nuclear-localized GCaMP6s. Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. |