| OH18872 |
ceh-44(ot1434[*ot1015[ceh-44::gfp]]) III. |
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 1-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18268 |
ceh-44(ot1402[*ot1015[ceh-44::gfp]]) III. |
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1402 is a deletion removing the UNC-75 binding site within intron 7 of the endogenously-tagged ceh-44 locus. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18203 |
ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III. |
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18410 |
cone-1(syb5437[GFP::cone-1]) ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III. |
GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. Normally broad, punctate expression of GFP::CEH-44 is not present. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18749 |
cone-1(ot1409[*syb5437[GFP::con-1]) III. |
syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1409 is a deletion removing exons 1-7 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18750 |
cone-1(ot1410[*syb5437[GFP::con-1]) III. |
syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1410 is a deletion removing exon 5 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH18948 |
ceh-44(ot1447[*ot1015[ceh-44::gfp]]) III. |
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH19119 |
cone-1(ot1485[*syb5500[cone-1::oxGFP]]) III. |
syb5500 is an oxGFP tag inserted at the C-terminus of the endogenous cone-1 locus by CRISPR. ot1485 is an early stop codon introduced into exon 3 of the endogenously-tagged cone-1 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH19120 |
ceh-44(ot1486[*ot1015[ceh-44::gfp]]) III. |
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1468 is an early stop codon introduced into exon 3 of the endogenously-tagged ceh-44 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH19186 |
cone-1(ot1502[GFP::H2B::SL2::cone-1]) III. |
GFP::H2B tag with SL2 inserted at N-terminus of endogenous cone-1 locus. Ubiquitous nuclear green at all stages (as early as 2-cell). GFP signal is very bright compared to C-terminal tag in OH19215. Please contact Oliver Hobert prior to publishing work using this strain. |
| RG3427 |
alkb-7(ve927[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 1410 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTAGGCATCAGAAGATCCATAATCAGTT ; Right flanking sequence: AAATTATGAAATTTTATCAAATGTTGCAGA. alkb-7 sgRNA A: CATCCTTCTGATCCTTGTGC; alkb-7 sgRNA B: GGAACTGTGGCCGAAGGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3426 |
gsto-1(ve926[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 1355 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGACTGGTTTTAATATCAAAGGCCCAAATC ; Right flanking sequence: AGGTTCCGCATCTCCTTTTCGAATTGCTTT. gsto-1 sgRNA A: ATAATTCAATTCCTGGTGCG; gsto-1 sgRNA B: AAAGATCCCTTTGATAGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| JH3616 |
par-1(ax4206[par-1::meGFP]) V. |
meGFP tag inserted at C-terminus of endogenous par-1 locus. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118 |
| EG7340 |
oxIs609 X. |
oxIs609 [acr-5p::GAP-43::GFP + lin-15(+)] X. GFP localized to axonal membranes of acr-5 expressing neurons. acr-5 promoter drives expression of reporter containing 40 aa myristoylation sequence of GAP43 fused to GFP. oxIs609 was generated by X-ray integration of oxEx81in N2 background. Reference: Rawson RL, et al. Curr Biol. 2014 Mar 31;24(7):760-5. doi: 10.1016/j.cub.2014.02.025. PMID: 24631238. |
| OH19215 |
cone-1(ot1514[cone-1::SL2::GFP::H2B]) III. |
CRISPR reporter, substitution of SL2 for T2A. A broad nuclear expression begins around the Comma stage. Brighter expression with earlier initiation than T2A reporter. Expression becomes restricted to non-neuronal cells as animals mature to larval stages. Please contact Oliver Hobert prior to publishing work using this strain. |
| OH19219 |
ceh-44(ot1515[*ot1015[ceh-44::gfp]]) III. |
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain. |
| FT2465 |
xnSi85 I; hmg-5(xn168[hmg-5::gfp(11)] IV. |
xnSi85 [mex-5p::mito(matrix)::GFP(1-10)::nos-2 3’UTR] I. Split GFP HMG-5/TFAM labels mtDNA nucleoids in primordial germ cells and germ line. Reference: Schwartz AZA, et al. eLife. 2022 Oct 6:11:e80396. doi: 10.7554/eLife.80396. PMID: 36200990. |
| FT2064 |
hmg-5(xn107[hmg-5::gfp]) IV. |
GFP-tagged HMG-5/TFAM labels mtDNA nucleoids. GFP tag causes a reduction in number of mtDNAs. Reference: Schwartz AZA, et al. eLife. 2022 Oct 6:11:e80396. doi: 10.7554/eLife.80396. PMID: 36200990. |
| XIL949 |
tlp-1(thu49[tlp-1::SL2::H1::mCherry]) IV. |
SL2::H1::mCherry was inserted at the 3' end of the endogenous tlp-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL933 |
Y53G8AR.9(thu33[Y53G8AR.9::mCherry]) III. |
mCherry was inserted at the 3' end of the endogenous Y53G8AR.9 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9172 |
Y53G8AR.9(thu172[pes-1::2A::NeonGreen::H2B]) III. |
2A::NeonGreen::H2B was inserted at the 3' end of the endogenous pes-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9152 |
saeg-2(thu152[saeg-2::2A::H1::mCherry]) X. |
2A::H1::mCherry was inserted at the 3' end of the endogenous saeg-2 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9112 |
mab-5(thu112[mab-5::2A::H1::mCherry]) III. |
2A::H1::mCherry was inserted at the 3' end of the endogenous mab-5 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| XIL9126 |
cbp-1(thu126[cbp-1::2A::H1::mCherry]) III. |
2A::H1::mCherry was inserted at the 3' end of the endogenous cbp-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740. |
| NFB2682 |
him-8(e1489) IV; osm-5(syb6528[osm-5::SL2::GFP::H2B]) X. |
SL2::GFP::H2B tag inserted at the C-terminus of the endogenous osm-5 locus by CRISPR. GFP expression labels ciliated sensory neurons. Him. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480. |
| NFB2456 |
daf-19(of5) II; wgIs652. |
wgIs652 [fkh-8::TY1::EGFP::3xFLAG + unc-119(+)]. CRISPR-engineered allele of daf-19 affects only isoforms a and b. De-repression of fkh-8 expression in neurons. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480. |
| XE2795 |
ric-7(wp127[ric-7::gfp11x7]) V. |
wp127 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous ric-7 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: Wu Y, et al. bioRxiv [Preprint]. 2023 Jul 12:2023.07.12.548706. doi: 10.1101/2023.07.12.548706. Update in: J Cell Biol. 2024 May 6;223(5): PMID: 37502914. |
| NFB2057 |
fkh-8(vlc43) II; otIs395. |
otIs395 [ift-20p::NLS::tagRFP + pha-1(+)]. Ciliome defects. CRISPR-engineered fkh-8 null mutation. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480. |
| PHX2307 |
ceh-13(syb2307[ceh-13::mNG::AID]) III. |
mNeonGreen and AID tags inserted into endogenous ceh-13 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866. |
| PHX6129 |
ieSi57 II; Y47D3A.21(syb6129[GFP::AID:::3Xflag::3xGAS::Y47D3A.21]) III. |
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. GFP, AID, 3xFLAG, and 3xGAS tags inserted into endogenous Y47D3A.21 locus. Reference: Sharma N, et al. bioRxiv [Preprint]. 2024 Jan 19:2024.01.16.575916. doi: 10.1101/2024.01.16.575916. PMID: 38293206. |
| RG3444 |
lonp-2(ve944[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 5206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTACTGCCAGGCGCAAGCCTTAAAATACCT ; Right flanking sequence: TGGGCCATCTGCTGGAACAGGATTAGCGTG. lonp-2 sgRNA A: CACTTTAATTTCGACCTGAT; lonp-2 sgRNA B: TCTTTATTCACCGCACCTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3445 |
T02C1.2(ve945[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 1978 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAACTCTTTTGCTTACCAGAGTATTTTAT ; Right flanking sequence: TGGTAAAAAAACCATGAATTTATAATTTCC. T02C1.2 sgRNA A: TCATATTTTCCAATTCCAGG; T02C1.2 sgRNA B: GTTCCGTATTCGGTGTCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| FQ63 |
lin-15AB(n765) X; wzIs20. |
wzIs20 [lgc-55p::GFP + lin-15(+)]. lgc-55 regulatory sequences drive expression of GFP in neurons, GLR cells and some muscles. Reference: Ringstad N, et al. Science. 2009;325(5936):96-100. doi:10.1126/science.1169243 |
| MT15934 |
irk-1(n4895) X. |
Egl-c. Suppresses egg-laying defect of egl-6(gf). Reference: Emtage L, et al. J Neurosci. 2012 Nov 14;32(46):16285-95. doi: 10.1523/JNEUROSCI.2667-12.2012. PMID: 23152612. |
| RG3421 |
F44E5.4 & F44E5.5(ve921[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 4584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:AATTAATCAACTTCCTCAACAGTAGGTCCT ; Right flanking sequence:AATGTTGTTCTAATAAATTTACAAAAATCT. sgRNA: AATCCTAACAATTATCCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3428 |
cal-1(ve928[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTACGAACTCTTCGTAATCAATTTCCCC ; Right flanking sequence: CGGTTTGCTTACCATATCTCTGGCGAGTCG. cal-1 sgRNA A: AAGTTGATGTGGATGGAGAC; cal-1 sgRNA B: TTCATGCTCCATGTTAGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3433 |
gst-22(ve933[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 1174 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCATCATTATTTTTTCTTTCACaaaaaaa ; Right flanking sequence: TTTGTAAGAGGGCATATTTTATTTGTGAAG. gst-22 sgRNA A: aCAATTCACACAAGCGTCAC; gst-22 sgRNA B: CTGACTTACTTTGATGCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3437 |
gln-5(ve937[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 1358 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCCAATTGAAAGCTAAAAATTCAGAAAGAT ; Right flanking sequence: TTGACCGAGAGGAAGACGAGTTTCGTAGTT. gln-5 sgRNA A: CATGCGTTAGTTTATTCGGG; gln-5 sgRNA B: GCCACCATCGATCATTTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3434 |
gsto-2(ve934[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 1049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGTGCAATTTGTCATCATGTAGGCTTCCG ; Right flanking sequence: TGGATTGTAAATATCTTCTCTTCGTTACAA. gsto-2 sgRNA A: GGGAAGGAAGTAAACACAGG; gsto-2 sgRNA B: GGAGCACCAAACTTTGACTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3430 |
R02F2.1(ve930[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 4303 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCATCTTCTACTGTCATTTCCAAATTCCCA ; Right flanking sequence: CTCTCATACTAATACAAATTCTATATATAT. R02F2.1 sgRNA A: CTCGTCTTCGTTCTGTAACA; R02F2.1 sgRNA B: AGATGGTGTGTGGGGGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3436 |
srp-7(ve936[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCCGAATCTCTCGCATTTTCTCCACTTTC ; Right flanking sequence: TTTTCAAGCAGATCATCCTTTCCTCTTTAT. srp-7 sgRNA A: CATTGCCTTAGCTCTATCTC; srp-7 sgRNA B: ACGATTGGCTTTATAGCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3435 |
W01A11.1(ve935[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 2962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCGTTGCAATCGGGGTTCTCGCCGCCG ; Right flanking sequence: AGGTCTCCCGTCATTCCTATAACATCACCC. W01A11.1 sgRNA A: CGGCAACAAATTCCATACGG; W01A11.1 sgRNA B: CTATGACCGTACACCAATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3431 |
agt-1(ve931[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 840 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGAAAATCTGAGTTCAGCGCCTTCTGCCT ; Right flanking sequence: CGGATGATCATTTCTACTTTAATAAAATTG. agt-1 sgRNA A: GAAGAAGCGTCGCCTATTGC; agt-1 sgRNA B: CGACTTCATAGACGCACTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3432 |
alh-9(ve932[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tcagttttcgtcgtcataaacaatctgccc ; Right flanking sequence: TGGAGGTCGCGAATCAGGATCCGACTCCTG. alh-9 sgRNA A: gtatgggcggagcgagacac; alh-9 sgRNA B: GGCGGAGAAAAGGAGACCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3443 |
avr-14(ve943[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Prone to rupture at vulva, can be maintained as a homozygous population. Deletion of 5798 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAGGTAATCGTTTAACACTACGATATGCT ; Right flanking sequence: agggctttttcttttttctctctttatcct. avr-14 sgRNA A: GATAAATCTAATCGAAGTGG; avr-14 sgRNA B: aagggacaggggacgaaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3442 |
col-58(ve942[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 643 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acattacaccgtaattacactttatcacct ; Right flanking sequence: AGGTGATGACATATCAGTGCTTCGTCACGA. col-58 sgRNA A: aaaggaaggatgggttggtg; col-58 sgRNA B: GGAGTTCCGGGATCATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| NOB142 |
daf-2(e1370) III; isp-1(qm150) IV/nT1[qIs51] (IV;V). |
Maintain at 15-20C: will form dauers at higher temps. Slow growing. Pick GFP+ to maintain. Heterozygotes are GFP+ and segregate WT GFP+ hets, arrested nT1[qIs51] aneuploids, and non-GFP daf-2(e1370); isp-1(qm150) homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. [NOTE: Originally published daf-2(e1370); isp-1(qm150) strain MQ876 was found to not actually contain the daf-2(e1370) mutation. This strain was made to study the double mutant and revealed that daf-2(e1370); isp-1(qm150) homozygotes are inviable/sterile.] Reference: Cooper et al. In preparation. |
| OH17801 |
him-5(e1490) V; otIs870. |
otIs870 [mir-228p::3xNLS::TagRFP] Pan-glial expression of tagRFP reporter. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| OH19295 |
unc-25(ot1536[unc-25b.1::T2A::GFP::H2B]) III; him-5(e1490) V. |
CRISPR-engineered T2A::GFP::H2B insertion specifically tags isoform b.1 of the endogenous unc-25 locus. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
| CFJ302 |
unc-119(kst33) III. |
Maintain at 15C. Temperature-sensitive unc-119 allele. Wild-type at 15C, intermediate Unc and Egl at 20C, and fully penetrant Unc and Egl at 25C. For use in transgenesis, maintain the strain at lower temperatures for increased brood size and easier injection, then transfer animals to 25C to select for transgenic animals based on Unc rescue. Molecular characterization shows a complex allele with a 210 bp duplication from a nearby exon-intron junction, which introduces 12 amino acids and a putative splice donor at a consensus splice acceptor site. The phenotype is most likely caused by temperature-sensitive splicing defects based on RT-PCR. Reference: Aljohani M, et al. Arrayed oligo libraries: genome-wide DNA- and RNP-based platforms for templated and non-templated CRISPR-Cas9 editing in C. elegans. (Submitted) |