Species Information: C. elegans

Name C. elegans
NCBI Taxonomy ID

C. elegans strains available at the CGC

Strain Genotype Description
AML376 juSi164 unc-119(ed3) III; wtfEx296. juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx296 [rab-3p::AI::gur-3G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Pick RFP+ to maintain. Keep plates covered to avoid unnecessary exposure to light. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML405 juSi164 unc-119(ed3) III; wtfEx315. juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx315 [5xQUAS::(delta)pes-10P::AI::gur-3G::unc-54 3'UTR + 5xQUAS::(delta)pes-10P::AI::prdx-2G::unc-54 3'UTR + rab-3p::AI::QF+hGR::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML438 juSi164 unc-119(ed3) III; wtfIs335. juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs335 [5xQUAS+(delta)pes-10p::AI::eTsChR::unc-54 3'UTR + rab-3p::AI::QF+hGR::SL2::tagBFP::unc-54 3'UTR + rab-3p::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal eTsChR on activation using dex treatment via QF+hGR. Worms also express calcium sensing fluorescence protein- GCaMP6s in nuclei of each neurons. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML535 wtfEx478. wtfEx478 [rab-3p::AI::lite-1G::SL2::tagBFP::unc-54 3'UTR + unc-122p::GFP]. Pick GFP+ animals to maintain. Worms express purple/violet light-sensitive optogenetic protein LITE-1 pan-neuronallly and nuclear-localized blue fluorescent protein tagBFP via SL2 trans-slpicing regulatory sequence. Worms also express GFP in coelomocytes. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML540 juSi164 unc-119(ed3) III; wtfIs483. juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs483 [rab-3p::AI::lite-1G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of a purple/violet light-sensitive optogenetic protein system LITE-1 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML580 wtfIs491. wtfIs491 [inx-1p::twk-18(gf)::mCherry + unc-122p::RFP]. AIB(-) activated potassium channel. Expression of twk-18 gain-of-function mutant in AIB neurons causes permanent inhibition. RFP expression in coelomocytes. Reference: Chen KS, et al. Olfactory learning alters navigation strategies and behavioral variability in C. elegans. ArXiv, Feb 23:arXiv:2311.07117v2. PMID: 38013890.
AML597 lgc-47(sy1501) X; wtfIs46. wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML614 lgc-47(sy1501) X; wtfIs46; wtfEx535. wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx535 [tdc-1p::AI::lgc- 47::SL2::his-24::tagRFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in RIML/R neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML617 lgc-47(sy1501) X; wtfIs46; wtfEx538. wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx538 [npr-9p::AI::lgc-47::SL2::tagBFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML618 lgc-47(sy1501) X; wtfIs46; wtfEx539. wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx539 [rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AVA neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML622 lgc-47(sy1501) X; wtfIs46; wtfEx543. wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx543 [tdc-1p::AI::lgc-47::SL2::his-24::tagRFP + npr-9p::AI::lgc-47::SL2::tagBFP + rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB, AVA, and RIM neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML627 acc-1 (tm3268) IV; wtfIs46. wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML73 pha-1(e2123)III; wtfEx48. wtfEx48 [rab-3p::Chrimson::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for animals carrying the array. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of Chrimson. Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
SLP266 sel-11(rem5) V. Prolonged lethargus sleep duration. rem5 is an early stop mutation, likely null. Reference: Kawano T., et al. Cell Rep. 2023 Mar 28;42(3):112267. PMID: 36924492.
SLP653 sel-1(rem32) V. Prolonged lethargus duration. Reference: Kawano T., et al. Cell Rep. 2023 Mar 28;42(3):112267. PMID: 36924492.
AM1246 rmIs126 X. rmIs126 [unc-54p::Q0::YFP]. Diffuse distribution of Q0::YFP throughout the body-wall muscle cells. Worms maintain a soluble phenotype for the duration of their lifespan. [NOTE: This strain is a replacement for AM134, which was removed from distribution due to reports that it did not carry the correct transgene.]
RG3460 B0281.8(ve960[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1112 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGTCATATTTTTTTGCTTCTCTATCGCCT ; Right flanking sequence: TCGCAGATTTCGCATTTTGGCACTTGCATT. B0281.8 sgRNA A: GAGACATGTTAAAGATATTG; B0281.8 sgRNA B: TGATGACTTCTCAAGTGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3450 F26D11.1(ve950[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 440 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATGTAGAGAAAATGAAAGCCGGCACACCA ; Right flanking sequence: CGTCACTGTTGATGCGAATAGTGAAAATGT. F26D11.1 sgRNA A: AGTCTATCAGAATCATTCAG; F26D11.1 sgRNA B: ATATTTGATTCATCGGGACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3454 B0281.3(ve954[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTCCAAAATGCAAGGCTCACCCGTATAA ; Right flanking sequence: ACCCATATGCAGCTATGAAACAACTGGATG. B0281.3 sgRNA A: TCTGGCTGAATTTTTCTGTG; B0281.3 sgRNA B: CTGACTCCCCACTACTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3458 C16D9.6(ve958[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1372 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGAATTTGACCCAATCAATGCCAGCTTTT ; Right flanking sequence: TGGCTCTAGGTGAATTATTTCTAGTCAGGA. C16D9.6 sgRNA A: GTTTGATGGAATGTATCCGA; C16D9.6 sgRNA B: ACATACAAACCTGTCATACG. Please referencAu et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3451 gst-1(ve951[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACTCAACTTCGTTCAATATGACCCTCAAG ; Right flanking sequence: TGGAAATGGAAAACAATAAGCTAATTCAAT. gst-1 sgRNA A: CTCACGTACTTCGACATCCA; gst-1 sgRNA B: GCTATCAACCCACCAGTAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3449 K03B8.6(ve949[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1958 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATGTGTGTTGGCCGTGTGTATGAAAGAGG ; Right flanking sequence: AAAAACgttttacgtgtatttttgttttat. K03B8.6 sgRNA A: CGTGGTTTGAGTCTGTCTGG; K03B8.6 sgRNA B: AAGAAAAGGCGGTGAAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3447 +/mT1 [umnIs52] II; mdh-2(ve947[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 1490 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae, (ve947 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctgttcatcatgtttcacgtggatgagag; Right flanking sequence: CGGCAACTCCTGGAGTATTGACGACGTCGT. mdh-2 sgRNA A: ggaagagacacagacagcgc; mdh-2 sgRNA B: ATCAATGTGCGAAAGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3452 +/mT1 [umnIs52] II; mlc-3(ve952[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Arrested larvae. Deletion of 1712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested early-stage larvae (ve952 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tttccacactcagtcccccctgctctgccg; Right flanking sequence: CTCAAGGGAGTCGAAGACGGAGAAGGCATG. mlc-3 sgRNA A: atgtgtgagtgttgcagcgg; mlc-3 sgRNA B: GAGCTCATCGGCCTCATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3456 ncs-7(ve956[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 4799 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGAGCTTGAGGTGGTCCCGCCGCCGCCC ; Right flanking sequence: TGGGCTTGAAATGGGCAATTCGGAATTCCA. ncs-7 sgRNA A: GATGCCCATGTCATAGTCGG; ncs-7 sgRNA B: CTTTGTTGTGTGTACTGGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3457 F37A8.5(ve957[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACAGTATAATATAATCTATTTTCCACCC ; Right flanking sequence: AGGGGAAATTTATTATCGAGCTGGCACATA. F37A8.5 crRNA A: AAAGGAGAAGCACAAGGAGG; F37A8.5 crRNA B: ATCGAGTCAAAAGTATAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3461 pfk-1.1(ve961[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 4271 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAAATACTATTGTCATAAATTACAGAATTT ; Right flanking sequence: CGACCGTTGAAAGTTCTGCAATTTTGGAAT. pfk-1.1 crRNA A: TGCATAATTCGAAATGGACG; pfk-1.1 crRNA B: AACGATGACGAGCGAGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3466 cpr-4(ve966[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATGATGGTGCTGCGTCACATGACTACCT ; Right flanking sequence: CATTGCAAAAAATGAAAGCCCCCAATTTTT. cpr-4 crRNA A: ATAGACAATGCCTAATTAGG; cpr-4 crRNA B: AAATGATATTACCCGGAGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3467 zipt-1(ve967[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 1175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATACACAGGTCTATGGCGAGCTGGAACCC ; Right flanking sequence: GAGAATATGGCTCCGCGCCCATTCTCCTTT. zipt-1 crRNA A: TTCTTGTACTTTCTCATCCC; zipt-1 crRNA B: TCGTTCATCTCGTGCATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CYA3 rexEx1. rexEx1 [myo-2p::GFP::Halo + mec-7p::mRFP]. Pick GFP+ to maintain. Mosaic expression of green fluorescence (GFP) in pharynx and red fluorescence (mRFP) in touch-receptor neurons.
CYA4 rexEx2. rexEx2 [ges-1p::GFP::Halo + mec-7p::mRFP]. Pick GFP+ to maintain. Mosaic expression of green fluorescence (GFP) in the intestine and red fluorescence (mRFP) in touch-receptor neurons.
CYA5 rexEx3. rexEx3 [myo-3p::GFP::Halo + mec-7p::mRFP]. Pick GFP+ to maintain. Mosaic expression of green fluorescence (GFP) in body-wall muscle and red fluorescence (mRFP) in touch-receptor neurons.
CYA6 rexEx4. rexEx4 [myo-2p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in pharynx. P2A is the self-cleaving peptide sequence.
CYA7 rexEx5. rexEx5 [ges-1p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in the intestine. P2A is the self-cleaving peptide sequence.
CYA8 rexEx6. rexEx6 [myo-3p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in body-wall muscle; punctate mCherry signals in some animals. P2A is the self-cleaving peptide sequence.
CYA9 cyp-33E1(syb8800) IV; ldrIs1. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. cyp-33E1(syb8800) is Cys295 mutated to Ala. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing syb8800 with LIU1 and out-crossing with N2.
CYA10 cyp-33E1(syb8844) IV; ldrIs1. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. cyp-33E1(syb8844) is Cys439 mutated to Ala. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing syb8844 with LIU1 and out-crossing with N2.
CYA11 ldrIs1; eeeIs1. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. Derived by crossing parental strains LIU1 and EAK102. YFP is fused to a fragment of mutant human Huntingtin protein; expression in body wall muscle cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
CYA12 ldrIs1; eeeIs2. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-54 3'UTR]. Motility defect. Derived by crossing parental strains LIU1 and EAK103. YFP is fused to a fragment of mutant human Huntingtin protein; expression in body wall muscle cells of the pharynx in adults and punctate expression in body wall muscle cells of larval animals. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
CYA13 frSi17 II; rde-1(ne300) V; ldrIs1. frSi17 [mtl- 2p::rde-1 3'UTR] II. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. Derived by crossing parental strains IG1839 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. frSi17 inserted into ttTi5605 site.
CYA14 rde-1(ne300) V; neIs9 X; ldrIs1. neIs9 [myo-3p::HA::rde-1 + rol-6(su1006)] X. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. Rollers. RDE-1 activity is rescued in the body-wall muscle, making animals RNAi-deficient except for body-wall muscle cells. Derived by crossing parental strains WM118 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
JDW390 bli-2(wrd85[bli-2::mNG::3xFLAG]) II. Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous bli-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW436 nas-37(wrd106[nas-37:::mNG::3xFLAG]) X. Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous nas-37 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW478 cpz-1(wrd128[cpz-1::mNG::3xFLAG::linker]) I. Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 4 of the endogenous cpz-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW650 dpy-4(wrd228[dpy-4::mNG::3xFLAG]) IV. Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dpy-4 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW651 dpy-14(wrd229[dpy-14::mNG::3xFLAG]) I. Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dpy-14 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW652 rol-8(wrd230[rol-8mNG::3xFLAG]) II. Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous rol-8 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW653 sqt-2(wrd231[sqt-2::mNG::3xFLAG]) II. Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous sqt-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW654 ram-2(wrd232[ram-2::mNG::3xFLAG]) II. Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous ram-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW655 cut-2(wrd233[cut-2::mNG::3xFLAG]) V. Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous cut-2 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.