Strain Information
| Name | CSM1323 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | twk-7(mac510) III. |
| Description | twk-7 loss-of-function allele. Hyperactive forward locomotion. twk-7(mac510) is a 10-bp deletion and 2-bp insertion in exon 9, causing a frameshift:aatttattttcagGTAAAAAAGAACGCAGCAACGGAGACATGGACATTTTCATCGTCCAT TTTCTTTGCCGTAACCGTCGTCACTACCATCGGATACGGTAATCCAGTTCCAGTGACAAA CATTGGACGGATATGGTGTATATTGTTCTCCTTGCTTGGAA(TACCTCTAAC)del(AA) insACTGGTTACCATCGCTGACTTGGgtaagtgg. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Chuanman Zhou |
| Laboratory | CSM |
| Reference | Zhou C, Zhou Q, He X, He Y, Wang X, Zhu X, et al. Differential modulation of C. elegans motor behavior by NALCN and two-pore domain potassium channels. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126 |
Sign in
or
register an account if you want to order this strain.