| GE2512 |
xpf-1(e1487) II; unc-24(e138) trcs-1(t1909)/nT1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. |
Leaky temperature-sensitive maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1909 homozygotes that produce dead eggs at restrictive temperature. GE2512 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9. |
| GE2305 |
xpf-1(e1487) II; unc-24(e138) wapl-1(t1867)/nt1[let (m435)] IV; dpy-11(e224)/nT1[let (m435)] V. |
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1867 homozygotes that do not produce viable progeny. GE2305 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9. |
| GE2153 |
xpf-1(e1487) II; unc-24(e138) wapl-1(t1773)/nt1[let (m435)] IV; dpy-11(e224)/nt1[let (m435)] V. |
Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1773 homozygotes that do not produce viable progeny. GE2153 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9. |
| GE2734 |
xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2029)/nt1[let (m435)] V. |
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2029 homozygotes that produce unfertilized oocytes. GE2734 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9. |
| GE2886 |
xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) C56A3.8(t2055)/nt1[let (m435)] V. |
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2055 homozygotes that produce unfertilized oocytes. GE2886 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9. |
| GE2122 |
xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) cept-2(t2007)/nt1[let (m435)] V. |
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2007 homozygotes that produce dead eggs. GE2122 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9. |
| GE2047 |
xpf-1(e1487) II; unc-24(e138)/nt1[let (m435)] IV; dpy-11(e224) cept-2(t2021)/nt1[let (m435)] V. |
Temperature-sensitive maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2021 homozygotes that produce dead eggs at restrictive temperature. GE2047 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9. |
| GE2541 |
xpf-1(e1487) II; unc-24(e138)/nT1[let (m435)] IV; dpy-11(e224) dlat-1(t2035)/nT1[let (m435)] V. |
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2035 homozygotes that produce dead eggs. GE2541 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9. |
| GE2335 |
xpf-1(e1487) II; unc-24(e138)/nT1[let (m435)] IV; dpy-11(e224) dlat-1(t2056)/nT1[let (m435)] V. |
Maternal effect lethal mutation linked to dpy-11(e224) and pseudolinked to unc-24(e138), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t2056 homozygotes that produce dead eggs. GE2335 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9. |
| GE1742 |
unc-32(e189) bckd-1A(t1461)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. |
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1461 homozygotes that produce dead eggs. GE1742 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
| GE2200 |
unc-32(e189) bckd-1A(t1480)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. |
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1480 homozygotes that produce dead eggs. GE2200 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
| GE2237 |
unc-32(e189) pod-1(t1614)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. |
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1614 homozygotes that do not produce viable progeny. GE2237 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
| GE2605 |
unc-32(e189) pod-1(t1674)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. |
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1674 homozygotes that do not produce viable progeny. GE2605 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
| GE2277 |
unc-32(e189) such-1(t1496)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. |
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1496 homozygotes that do not produce viable progeny. GE2277 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
| GE2666 |
unc-32(e189) such-1(t1693)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. |
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1693 homozygotes that do not produce viable progeny. GE2666 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
| GE1735 |
unc-32(e189) top-3(t1470)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. |
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1470 homozygotes that produce arrested embryos. GE1735 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
| GE2399 |
unc-32(e189) top-3(t1559)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. |
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1559 homozygotes that produce arrested embryos. GE2399 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
| GE1713 |
unc-32(e189) ZK688.9(t1433)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. |
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1433 homozygotes that produce arrested embryos (approximately 100 cells). GE1713 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
| GE2621 |
unc-32(e189) ZK688.9(t1587)/qC1[dpy-19(1259) glp-1(q339)] III; him-3(e1147) IV. |
Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1587 homozygotes that produce arrested embryos. GE2621 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. |
| NLS1 |
cdc-7(knu709) I. |
CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912. |
| RG3281 |
pdi-3(ve781[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 4472 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagtcgaagctgcaaacaataaataaataa ; Right flanking sequence: gggaacaccgacaaaaagttaaaaactaag. sgRNA #1: attacaaaagggaaacaacg; sgRNA #2: ttagagggcgagagattatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3282 |
+/nT1[umnIs49] IV; Y61A9LA.10(ve782[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 8730 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve782 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctTCAGGAGCTGCTCGCCGATGAGCCAAGA ; Right flanking sequence: cacggcgtgcgcgtcagtgtcacgaaacgc. sgRNA #1: GCAAAACTTCGAAAGGCTCT; sgRNA #2: aaattggttgctgacgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3283 |
+/mT1 [umnIs52] II; pod-1(ve783[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous maternal effect lethal. Deletion of 9240 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that lay dead eggs (ve783 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gagacaaataaaaagcgagagagggagagg ; Right flanking sequence: tggcccgaaatttatatcaattttgcggac. sgRNA #1: tggtgatggattggtgatgg; sgRNA #2: agcgcacacacaaacacaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3284 |
eif-3.C(ve784[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. |
Homozygous early larval lethal. Deletion of 2440 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve784 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTCTGCTGAGCATACGACGACGCATTTCG ; Right flanking sequence: ttaaataataatttattatttaatcacaat. sgRNA #1: AATTCGCAACTAGCCATGTG; sgRNA #2: atctccgcgcaaatgcccac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3285 |
cyp-42A1(ve785[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. |
Homozygous Emb as unbalanced heterozygote. Deletion of 3977 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, dead eggs (ve785 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type GFP+. Left flanking Sequence: TTCGCATTCCGGAAAGCAAAATTCATTTAC ; Right flanking sequence: TGGTTCCTCCACTTAATGGGAGCAAATCCA. sgRNA #1: AACAAGCTTACGGTCTTCCA; sgRNA #2: CAACATCAGCCGCAATGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details.
doi.org/10.1038/s41598-021-97764-9 |
| RG3286 |
H40L08.3(ve786[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. |
Homozygous viable. Deletion of 6197 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTTGAGATTTAGCAAGTAAATTGAGA ; Right flanking sequence: AGGATAATAATCGTTTTACCAGAGGCAAAG. sgRNA #1: ACGGAGTGTTCTAGGCGTCG; sgRNA #2: GTTTCACATCTCCGTTTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3287 |
C23G10.7(ve787[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 3575 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tccttgtatcgtccatttgaatgtcatcca ; Right flanking sequence: cagtgaaaaattaagcattagagcggtcaa. sgRNA #1: agtgaattttgtggcggctt; sgRNA #2: atcgtctcaaagctatgcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3288 |
F41C3.8(ve788[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. |
Homozygous viable. Deletion of 2556 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caatttcactggtctatttctatttcgcca ; Right flanking sequence: GGGATCCGTTAAAGAATCTTCATCACAAGA. sgRNA #1: ttgtcacacgctcatacgtg; sgRNA #2: GTTATTTGCCTACTCATAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CGC171 |
mir-799(umn78[mir-799p+SL1::EGL13NLS::lox2272]) X. |
Deletion of mir-799 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG. |
| CGC172 |
mir-799(umn79[mir-799p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. |
Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG. |
| CGC179 |
mir-82(umn86[mir-82p+SL1::EGL13NLS::lox2272]) X. |
Deletion of mir-82 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC. |
| CGC180 |
mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. |
Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC. |
| CGC169 |
mir-788(umn76[mir-788p+SL1::EGL13NLS::lox2272]) X. |
Deletion of mir-788 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG. |
| CGC170 |
mir-788(umn77[mir-788p+SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. |
Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG. |
| JN1483 |
daf-18(pe407) IV. |
pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490 |
| HAL100 |
xpf-1(emc57[xpf-1::GFP]) II. |
GFP tag inserted into endogenous xpf-1 locus. Ubiquitous GFP expression. Reference: Sabatella M, et al. Cell Rep. 2021 Jan 12;34(2):108608. PMID: 33440146 |
| GJ3452 |
gcy-22(gj1976[gcy-22::GFP]) V. |
GFP tag inserted into endogenous gcy-22 locus. GCY-22::GFP expression in the ASER neuron localized at cilium tip and PCMC. Reference: van der Burght SN, et al. Curr Biol. 2020 Nov 2;30(21):4299-4306.e5. PMID: 32916106 |
| WF1828 |
hda-1(cw2) II. |
hda-1(cw2) mutants are viable as homozygotes, although many die as embryos or larvae. Severely uncoordinated with defective vulval development and reduced fertility. Reference: Zinovyeva AY, et al. Dev Biol. 2006 Jan 1;289(1):229-42. PMID: 16313898 |
| QC158 |
paqr-1(et52) IV. |
paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056 |
| RG3289 |
+/mT1 [umnIs52] II; trmt-10C.2(ve789[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. C56G2.3. Homozygotes arrest as late larvae or become sterile adults. Deletion of 1669 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve789 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acttctggactttaattcccttacctatta ; Right flanking sequence: aggtgaagctgagcgtggcaactcacttca. sgRNA #1: cccagtgacgatattgagat; sgRNA #2: tttctctagctctttcagac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3291 |
cox-18(ve791[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. |
Homozygous Ste, Pvl. Deletion of 2404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ heterozygotes, GFP+ Ste Pvl adults (ve791 homozygotes), and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: gaaattcgaaatctacgcaaaatttcagcg ; Right flanking sequence: agggcaaaaaaaaaattgcttaagcctgag. sgRNA #1: accaaatcacgaaaactaga; sgRNA #2: tgaccccaaccagtttctga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3293 |
ugt-20(ve793[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 2672 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATCAGAATAAAAATTGCGATAATGTCCA ; Right flanking sequence: tggtgtcaagatttttttgtacagagagac. sgRNA #1: ATTCGTTGAGTACTTCTTTT; sgRNA #2: atcctaacagttctgcccag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3295 |
Y53G8AL.1(ve795[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. |
Homozygous viable. Deletion of 6742 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGGAGAACGACTATTGGAAGTGCTCCG ; Right flanking sequence: cggaatcggaaaattcagaaaatttcagtt. sgRNA #1: TTGAGCACCACATCACAGGT; sgRNA #2: aaatcatgttacagctgtag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3296 |
T20D3.6(ve796[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. |
Homozygous viable. Deletion of 526 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagaacattttatgaatcaaaagTTAAGCA ; Right flanking sequence: CGGAAGTCATGTGGCTCGGCGTTCATtttt. sgRNA #1: GAATTATTCTGAGGAACCGC; sgRNA #2: TTATATGCGCTTTGTGATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3297 |
+/nT1[umnIs49] IV; F25H9.6(ve797[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Sterile. Deletion of 1068 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve797 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aatagaagaaaaatatgatattgtCTACCC ; Right flanking sequence: AATTCGTCGGACATgttaaccgaacaagtt. sgRNA #1: AGGCAGTTCGCATCCAATGC; sgRNA #2: ATCAGTGAAAAGGCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CZ24274 |
dhc-1(lt45[dhc-1::GFP]) I; ltSi953 II; unc-119(ed3) III. |
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826. |
| CZ24092 |
gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. |
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826. |
| BFF40 |
mjIs134 II; meg-3(tm4259) meg-4(ax2026) X. |
mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Germ granule defective. ~30% sterility, maintain by picking gravid adults with visible embryos. Nuclear GFP expression in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614 |
| BFF48 |
mjIs134 II; hrde-1(tm1200) III. |
mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, Mortal germline (Mrt) at 25C. Expressing nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614 |
| BFF49 |
mjIs134 II; hrde-1(tm1200) III; meg-3(tm4259);meg-4(ax2026) X. |
mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, germ granule defective, high sterility. Expresses nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614 |
