Laboratory Information
| Name | PD View on WormBase |
|---|---|
| Allele designation | cc |
| Head | Andrew Z. Fire |
| Institution | Stanford University, Stanford, CA |
| Address | 300 Pasteur Dr Lane building, L235 Stanford 94305 United States |
| Website | http://genome-www.stanford.edu/group/fire/ |
| Gene classes | cey lmp mls tam pelo |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| CB4027 | tra-3(e1107) eIs2137 IV. | C. elegans | eIs2137 [sup-7(+) + Dm-hsp::lacZ] IV. lacZ expression induced by heat shock. Limited pattern (the pSHZ1 vector was originally designed for use in Drosophila, not C. elegans, and is not the best vector for expression of lacZ in the worm). This strain has predominantly historical value (as the first C. elegans strain shown to express a foreign gene). eIs2137 transgene is integrated and contains two plasmids: pAST (sup-7 amber suppressor), and pSHZ1 (lacZ driven by Drosophila heat shock promoter (S. Munro)). |
| CB5009 | let-552(e2542)/dpy-25(e817) II. | C. elegans | At 20C or 25C heterozygotes are semi-Dpy and segregate semi-Dpys (heterozygotes), Dpys (dpy-25/dpy-25) and animals which arrest as Dpyish young larvae (let-552/let-552). Maintain by picking semi-Dpy. At 15C it is difficult to distinguish between let-552 homozygotes and dpy-25 homozygotes (e817 is inviable at 15C). |
| CGC1 | C. elegans wild isolate. | C. elegans | CGC1 (formerly known as PD1074) is intended to be used as a wild-type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). CGC1 is a defined and recently cloned population of animals derived from the original "Bristol" variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner's original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. CGC1 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. We note that CGC1 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in CGC1. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019). |
| HT115(DE3) | E. coli [F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase]. | Escherichia coli | Bacteria. Genotype: F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase) (IPTG-inducible T7 polymerase) (RNAse III minus). This strain grows on LB or 2XYT plates. This strain is tetracycline resistant. Researchers using this strain should test for expression by transforming in one of the plasmids from the Fire Vector Kit (1999) (pLT76, e.g.) using standard CaCl2 transformation techniques. Biosafety Level: BSL-1. |
| NH2447 | ayIs2 IV. | C. elegans | ayIs2 [egl-15p::GFP + dpy-20(+)] IV. GFP expression in vm1 sex muscles and other miscellaneous cells. |
| PD126 | unc-54(e190) I; ccIs126. | C. elegans | ccIs126 [myo-2p::lacZ + unc-54(+)]. lacZ expression in pharyngeal and body wall muscles. Superficially wild-type, but gives some paralyzed animals. |
| PD1301 | lin-14(cc2841[lin-14::GFP]) X. | C. elegans | Endogenous lin-14 locus tagged with GFP. Reference: Arribere JA et al. Genetics. 2014 Nov;198(3):837-46. |
| PD1594 | ccTi1594 unc-119(ed3) III. | C. elegans | ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. GFP expression in germline. Transgene rescues unc-119(ed3). Improved GPR-1 over-expression transgene appears to be stably expressed in the germline at a wide range of temperatures and does not require special handling. (unlike other GPR-1 overexpressing transgenes previously described in the literature). The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance. Neomycin resistant. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD2217 | ccTi1594 unc-119(ed3) III; hjSi20 IV. | C. elegans | ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. hjSi20 [myo-2p::mCherry::unc-54 3'UTR] IV. GFP expression in germline. mCherry expression in pharynx. The ccTi1594 transgene rescues unc-119(ed3). High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD2218 | ccTi1594 umnIs7 III. | C. elegans | ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD2220 | ccTi1594 umnIs27 III. | C. elegans | ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs27 [myo-2::GFP + NeoR, III: 8856215 (intergenic)] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD2224 | oxIs322 II; ccTi1594 umnIs7 III. | C. elegans | oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)] II. ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. mCherry expression in pharyngeal and body wall muscle nuclei. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD2227 | oxIs322 II; ccTi1594 III. | C. elegans | oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)] II. ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. mCherry expression in pharyngeal and body wall muscle nuclei. GFP expression in germline. High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly. |
| PD2856 | unc-54(cc2856[unc-54::gfp]) I. | C. elegans | Green body muscle filaments, slightly sluggish movement. Functional translational fusion that provides a means to observe striated muscle thick filaments in real time. Reference: Nature. 2016 Jun 30;534(7609):719-23. |
| PD2859 | unc-54(cc2859[unc-54::GFP::TAA::NSUTR]) I. | C. elegans | Endogenous unc-54::GFP made by CRISPR. Exhibits green thick muscle filaments in the body wall muscle. Weakly Unc. Reference: Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. Translation readthrough mitigation. Nature. 2016 Jun 30;534(7609):719-23. Epub 2016 Jun 1. |
| PD2860 | pelo-1(cc2849) III; skih-2(cc2854) IV. | C. elegans | Temperature-sensitive. Weakly fertile at 16C; sterile at 23C. Incomplete de-repression of nonstop mRNAs. Reference: Arribere, JA and Fire, AZ. Nonsense-mediated decay triggers SKI/pelota-dependent decay in a metazoan. |
| PD2882 | unc-54(cc2882[unc-54[G387R]::gfp::TAA::NSUTR]) I. | C. elegans | cc2882 is a CRISPR/Cas9-induced G387R mutation of unc-54 in parental strain PD2859, mimicking the molecular lesion e1301. Unc at room temperature. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292. |
| PD3165 | unc-39(ct73) V; ccEx3163. | C. elegans | ccEx3163 [unc-39p::unc-39 gene (genomic fragment)::GFP::unc-39 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. ccEx3163 carries unc-39 construct pJLY99.1. |
| PD4092 | unc-54(cc4092[unc-54::GFP::T2A::nonstop]) I. | C. elegans | Unc. Reporter for non-stop mRNA decay, separate from non-stop protein decay. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292. |
| PD4251 | ccIs4251 I; dpy-20(e1282) IV. | C. elegans | ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts). |
| PD4285 | mls-1(cc569) III; ayIs2 IV. | C. elegans | ayIs2 [egl-15p::GFP + dpy-20(+)] IV. Adult midbody GFP pattern in 8 vm-1 type muscles (instead of 4 as in WT). mls-1(o) converts uterine to vulval muscles. |
| PD4443 | ccIs4443 IV. | C. elegans | ccIs4443 [arg-1::GFP + dpy-20(+) ]. GFP activity in diverse differentiated non-striated mesodermal lineages. Strain might contain dpy-20(e1282) in background. |
| PD4588 | ceh-24(cc539) V. | C. elegans | Deletion of entire ceh-24 gene except first five amino acids. No detectable phenotype. |
| PD4589 | dpy-11(e224) ceh-24(cc539) V. | C. elegans | Dpy. Deletion of entire ceh-24 gene except first five amino acids. |
| PD4595 | ccIs4595 IV. | C. elegans | ccIs4595 [ceh-24::GFP + rol-6(su1006)]. GFP expression in vulval muscles, m8, and set of neurons in the head. |
| PD4605 | hlh-1(cc561) II. | C. elegans | Temperature sensitive truncation allele of hlh-1. Animals are relatively healthy and fertile with M lineage transformations at 16C. At 25C, animals are very sick and few survive to fertility. |
| PD4655 | dpy-20(e1282) IV; ccIs4655. | C. elegans | ccIs4655 [pes-10::GFP + dpy-20(+) ]. GFP expression in lineages with active HLH-8/HLH-2 (e.g., sex muscle, head mesodermal cell). Transgene contains pes-10::GFP reporter driven by 8 copies of an HLH-8/HLH-2 response site from the ceh-24 promoter. |
| PD4666 | ayIs6 X. | C. elegans | ayIs6 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background. |
| PD4667 | ayIs7 IV. | C. elegans | ayIs7 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background. |
| PD56 | tra-3(e1107) IV; ccIs56 V. | C. elegans | ccIs56 [sup-7(st5) +unc-54::lacZ] V. Non-nuclear unc-54::lacZ fusion expressed in nuclei and cytoplasm of body wall muscles. |
| PD6133 | tam-1(cc567) V. | C. elegans | Homozygotes have decreased expression of tandem array transgenes, descreased fertility and high incidences of males at 25C. Maintain strain at 16C. |
| PD6247 | tam-1(cc567) unc-46(e177) V. | C. elegans | Unc. Decreased expression of tandem array transgenes, decreased fertility, and high incidences of males at 25C. Maintain at 16C. |
| PD6249 | ccIs4251 I; tam-1(cc567) V. | C. elegans | ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Homozygotes have decreased expression of tandem array transgenes, decreased fertility, and high incidences of males at 25C. Maintain at 15C. |
| PD7217 | let-852(cc504) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. |
| PD7218 | let-853(cc505) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. |
| PD7220 | let-854(cc507) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, paralyzed Dpys and dead eggs. cc507 is a recessive embryonic lethal. |
| PD7222 | let-855(cc509) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. |
| PD7227 | let-856(cc514) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. |
| PD7229 | let-857(cc516) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, paralyzed Dpys and embyronic lethals. |
| PD7244 | let-856(cc529) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. |
| PD7271 | pha-1(e2123) III; ccEx7271. | C. elegans | ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Sporadic germ cell expression can be observed when maintained at 25C. |
| PD8117 | smg-1(cc545) unc-54(r293) I. | C. elegans | Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).] |
| PD8118 | smg-1(cc546) unc-54(r293) I. | C. elegans | Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
| PD8119 | smg-1(cc545) I. | C. elegans | Temperature sensitive. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).] |
| PD8120 | smg-1(cc546) I. | C. elegans | Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
| PD8251 | ccIs228 V. | C. elegans | ccIs228 [myo-2p::lacZ + unc-22 (antisense)]. Mild twitchers (strong twitchers in 1% nicotine). lacZ expression in pharyngeal muscles. |
| PD8601 | ccDf1/dpy-25(e817) II. | C. elegans | Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. |
| PD8602 | ccDf2/dpy-25(e817) II. | C. elegans | Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. |
| PD8603 | ccDf3/dpy-25(e817) II. | C. elegans | Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. |
| PD8604 | ccDf4/dpy-25(e817) II. | C. elegans | Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. |
| PD8605 | ccDf5/dpy-25(e817) II. | C. elegans | Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. |
| PD8607 | ccDf7/dpy-25(e817) II. | C. elegans | Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. Rec'd new stock 8/2000. |
| PD8611 | ccDf11/dpy-25(e817) II. | C. elegans | Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. |
| PD8622 | (cc435) II. | C. elegans | This strain is NOT hlh-1(cc450) as previously listed. Strain grows more slowly than WT and is a little longer than WT. |
| PD8662 | lin-31(n301) hlh-1(cc450)/mnC1 [dpy-10(e128) unc-52(e444)] II. | C. elegans | Heterozygotes are WT and segregate WT, DpyUnc (mnC1 homozygotes) and larval lethals (lin-31 hlh-1 homozygotes). The lin-31 hlh-1 homozygotes are very Dpy and Lumpy and look like they hatched just after reaching the two-fold stage. See also WBPaper00001975. |
| PD8753 | dcr-1(ok247) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | dcr-1 homozygotes are completely sterile. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing steriles , very rare homozygous hT2 glowing animals, and dead eggs. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
| PD9927 | ced-9(n2812) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nIs106 X. | C. elegans | nIs106 [lin-11::GFP + lin-15(+)] X. Homozygous maternal effect lethal ced-9 mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ced-9 homozygotes (maternal effect lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| cc546 | Allele | ||
| cc561 | Allele | substitution | nonsense |
| cc615 | Allele | substitution | nonsense |
| cc604 | Allele | substitution | nonsense |
| cc609 | Allele | ||
| cc607 | Allele | substitution | nonsense |
| cc600 | Allele | substitution | splice_site |
| cc569 | Allele | ||
| cc539 | Allele | deletion | |
| cc567 | Allele | substitution | nonsense |
| cc504 | Allele | ||
| cc505 | Allele | ||
| cc507 | Allele | ||
| cc509 | Allele | ||
| cc514 | Allele | ||
| cc516 | Allele | ||
| cc529 | Allele | ||
| cc545 | Allele | ||
| cc8266 | Allele | ||
| cc450 | Allele |