Laboratory Information

NameCZ View on WormBase
Allele designationju
HeadAndrew D Chisholm
InstitutionUCSD
Address 9500 Gilman Dr. MC0368
Bonner Hall 2429
La Jolla 92092
United States
Website http://www-biology.ucsd.edu/faculty/chisholm.html
Gene classes cebp  cnd  col  dapk  ephx  ifa  ifb  ifc  max  mcrs  ptrn  spon  syd  sydn 
tbc  ubr  vac  bgal  ebax  fbxl  mctp  supr  lhrp  mfsd 

Strains contributed by this laboratory

Strain Genotype Species Description
CZ10123 rabx-5(qa7800) III. C. elegans rabx-5(qa7800) mutants show decreased protein localization of YFP::RAB-5 in the cell bodies but increased protein localization within the dorsal cord in both synaptic and intersynaptic regions
CZ10175 zdIs5 I. C. elegans zdIs5 [mec-4p::GFP + lin-15(+)] I. SK4005 was outcrossed 10x to produce this strain.
CZ11771 nsf-1(ty10) I; muIs32 II. C. elegans muIs32 [mec-7p::GFP + lin-15(+)]. Egl, semi-Sterile, embryonic & larval lethality. Lethal in trans to Df. Defective fusion of anchor cell to uterine seam. Maintain under normal conditions. Reference: Choi J, et al., Dev Biol. 2006 Sep 1;297(1):87-102.
CZ1200 juIs76 II; lin-15B&lin-15A(n765) X. C. elegans juIs76 [unc-25p::GFP + lin-15(+)] II.
CZ1251 rpm-1(ju41) V. C. elegans WT in movement. Abnormal synapses at GABAergic NMJs.
CZ13799 juIs76 II. C. elegans juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. [NOTE: (10/11/2018) CZ13799 was sent as a replacement for CZ1200, which was found to carry background mutations affecting neuron morphology.] Derived by outcrossing CZ1200 to remove lin-15(n765) and unidentified background mutations. Reference (for original juIs76 strain): Huang X, et al. Neuron. 2002 May 16;34(4):563-76.
CZ13896 juIs319. C. elegans juIs319 [col-19p::GCaMP3 + col-19p::tdTomato]. col-19p::GCaMP3 expression is induced by either laser or needle wounding. col-19 is an adult-specific collagen and is not expressed until the end of the L4 larval stage. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7.
CZ1455 cnd-1(ju29) III. C. elegans Reverse kinker.
CZ14748 juIs352. C. elegans juIs352 [col-19p::GFP::moesin]. GFP::moesin expression labels F-actin by fusing GFP to sequences that encoded the C-terminal end of the sole Drosophila MER homolog, moesin. The F-actin ring (GFP::moesin) is induced upon needle wounding. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7.
CZ1566 lin-15B&lin-15A(n765) juIs109 X. C. elegans juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510.
CZ16143 juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. C. elegans juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. RFP expression in AIY neuron. Weak light green signals were observed in the neurons using compound scope although this is only the former half of the split GFP. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
CZ1632 juIs76 II; max-1(ju39) V. C. elegans juIs76 [unc-25p::GFP + lin-15(+)] II. Very mild Unc.
CZ17515 juSi94 II; rps-18(ok3353) IV. C. elegans juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ1758 juIs76 II; max-1(ju142) V. C. elegans juIs76 [unc-25p::GFP + lin-15(+)] II. Very mild Unc.
CZ1774 vab-1(e856) ptp-3(op147)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.
CZ18018 juSi94 II; rps-18(ok3353) IV; juEx5375. C. elegans juSi94 [rps-18p::GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5375 [col-19p::GFP(1-10) + ttx-3p::RFP]. Pick RFP+ to maintain. Expression of split GFP reporter labels ribosomes in the epidermis. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
CZ18020 juSi94 II; rps-18(ok3353) IV; juEx5377. C. elegans juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5377 [myo-3p::GFP1-10 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. Muscle-specific expression of split GFP reporter allows visualization of ribosomes in muscle. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18058 juSi103. C. elegans juSi103 [col-19p::mito::GCaMP5]. GCaMP5 reporter labels hypodermal mitochondria. Reference: Xu S & Chisholm AD. Dev Cell. 2014 Oct 13;31(1):48-60. doi: 10.1016/j.devcel.2014.08.002. PMID: 25313960.
CZ18412 juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. C. elegans juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18423 juEx5375. C. elegans juEx5375 [col-19p::GFP(1-10) + ttx-3p::RFP]. Pick RFP+ to maintain. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
CZ18550 juSi123 II; rpl-29(tm3555) IV. C. elegans juSi123 [rpl-29::GFP] II. Strong GFP signal allowing visualization of ribosomes. GFP inserted at C-terminus of RPL-29. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18637 juSi83 II; rps-18(ok3353) IV/nT1[qIs51] (IV;V). C. elegans juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ1893 syd-1(ju82) II. C. elegans Egl. Coiler when moving backwards. Recessive. F35D2.5
CZ18975 juIs338. C. elegans juIs338 [mec-4p::ebp-2::GFP + ttx-3p::RFP]. Derived by integration of array in parental strain CZ12264. Reference: Ghosh-Roy A, et al. Dev Cell. 2012 Oct 16;23(4):716-28. Chen L, et al. Elife. 2015 Sep 4;4. doi: 10.7554/eLife.08695.
CZ19297 juSi94 II; rps-18(ok3353) juIs409 IV. C. elegans juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ1931 juIs76 II; unc-71(ju156) III. C. elegans juIs76 [unc-25p::GFP + lin-15(+)] II. Unc.
CZ1935 juIs76 II; unc-71(ju160) III. C. elegans juIs76 [unc-25p::GFP + lin-15(+)] II. Unc.
CZ19982 mcu-1(ju1154) IV. C. elegans Superficially wild-type. No uptake of calcium in mitochondria after wounding. Reference: Xu S, Chisholm AD. Dev Cell. 2014 Oct 13; 31:48-60.
CZ20132 juSi94 II; rps-18(ok3353) IV; juIs463. C. elegans juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. DD motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in those neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ20215 tba-1(ju89) I. C. elegans Gain-of-function allele isolated sem-4; juIs1 screen in 1997. ju89 has slightly semi-dominant effects, and the gf phenotype is most obvious in homozygous. This outcrossed strain does not carry a sem-4 mutation or juIs1. References: Kurup N, et al. Curr Biol. 2015 Jun 15;25(12):1594-605. Kurup N, et al. PLoS Genet. 2017 Jun 21;13(6):e1006844.
CZ20310 juSi164 unc-119(ed3) III. C. elegans juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. Maintain in the covered box to avoid unnecessary exposure to ambient light. Wild-type behavior in movement, mating, growth and brood size. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Wild-type behavior in movement, mating, growth and brood size. MosSCI insertion into oxTi444 on Chr. III. Reference: Noma K & Jin Y. Nature Communications, 2015.
CZ22695 juEx6908. C. elegans juEx6908 [nmr-1p::PH::miniSOG(Q103L) + nmr-1p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Interneuron expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22698 juEx6911. C. elegans juEx6911 [unc-25p::PH::miniSOG(Q103L) + unc-25p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in GABAergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22703 juEx6916. C. elegans juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22714 miro-3(ju1310) juSi271 I; miro-1(ju1306) IV; miro-2(ju1309) X. C. elegans juSi271 [col-19p::mito::Dendra2]. Superficially wild-type with altered mitochondrial morphology. Fluorescent reporter labels hypodermal mitochondria. Reference: Xu S, et al. J Genet Genomics. 2016 Feb 20;43(2):103-6.
CZ23277 juEx7101. C. elegans juEx7101 [col-19p::PH::miniSOG(Q103L) + ttx-3::RFP]. Pick RFP+ to maintain. Adult epidermal expression of PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ23279 juEx7103. C. elegans juEx7103 [unc-17p(beta)::PH::miniSOG(Q103L) + acr-2p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in cholinergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. [NOTE: strain was previously described as carrying ttx-3::GFP, but appears to be ttx-3::RFP instead.]
CZ23281 juEx7105. C. elegans juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ24092 gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. C. elegans ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
CZ24274 dhc-1(lt45[dhc-1::GFP]) I; ltSi953 II; unc-119(ed3) III. C. elegans ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
CZ2475 juIs145 II. C. elegans juIs145 [flp-13p::GFP + lin-15(+)] II. GFP expression in ASE, ASG, ASK, I5 and DD1-DD6. Reference: Wu Z, et al. Proc Natl Acad Sci USA. 2007 Sep 18;104(38):15132-7. PMID: 17848506.
CZ2485 ahr-1(ju145) I. C. elegans
CZ24969 sphk-1(ju831) II. C. elegans Aldicarb resistant. Reference: McCulloch KA, et al. G3 (Bethesda). 2017 Jul 5;7(7):2055-2063.
CZ24990 unc-44(ju1412[unc-44::GFP]) IV. C. elegans Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
CZ25013 unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. C. elegans unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
CZ252 itr-1(n2559)/lin-45(n2018) unc-24(e138) IV. C. elegans Heterozygotes are WT and segregate WT, Unc Lins and very slow growing constipated worms. n2559 is a null allele of itr-1.
CZ25708 prg-1(ju1574) I. C. elegans Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
CZ26389 esyt-2(ju1408) III. C. elegans CRISPR-engineered deletion of esyt-2 from middle of 5'UTR to middle of 3'UTR using guide RNAs crCP01 (GGTTTCAGTAATTGTGGGCT) and crCP02 (GTGCACTTACGGGTTGTAGG). Superficially wild-type. Reference: Piggott CA, et al. Genetics. 2021 Apr 19;iyab063. doi: 10.1093/genetics/iyab063. PMID: 33871019.
CZ26494 juSi364 IV; acr-2(n2420) X. C. elegans juSi364 [unc-17Bp::3xFLAG::eif-3.g::SL2::GFP] IV. GFP expression in cholinergic motor neurons. Convulsing worms. Strain is suitable for neuron-type eCLIP. Reference: Blazie S, et al. Elife. 2021 Jul 29;10:e68336. PMID: 34323215.
CZ26606 vwa-8(ju1659) X. C. elegans Superficially wild-type. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263
CZ26660 micu-1(ju1155) IV/nT1 [qIs51] (IV;V). C elegans Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP micu-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.
CZ2744 adm-4(ok265) X. C. elegans Wild type.
CZ27508 micu-1(ju1783[micu-1::gfp]) IV. C elegans GFP reporter inserted into C-terminus of endogenous micu-1 locus. Diffuse GFP signals throughout the body. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.
CZ27748 vwa-8(ju1799[vwa-8::GFP::3xFLAG]) X. C. elegans Endogenous vwa-8 locus tagged with GFP and 3xFLAG. VWA-8::GFP is expressed in mitochondria of hypodermis, intestine, and muscle, but not detectable in neurons. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263.
CZ29001 muIs32 II; degt-1(ok3307) V. C. elegans muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]
CZ3011 unc-16(ju146) III. C. elegans Uncoordinated and egg-laying defective. T to C transition resulting in L75P.
CZ3086 kin-1(ok338)/unc-54(r293) I. C. elegans Heterozygotes are WT and segregate WT, Unc, and early larval lethal.
CZ3103 juIs167. C. elegans juIs167 [vab-19::GFP + rol-6(su1006)]. Integrated by UV/TMP. Rollers. Received new stock Feb 2005.
CZ333 juIs1 IV. C. elegans juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82.
CZ337 vab-1(dx31) II. C. elegans Strong Vab-1 phenotype. About 50% embryonic lethality and about 30% larval lethality. Genetic null.
CZ3391 vab-3(ju468) X. C. elegans Vab. Notched Head. Distal tip cell Mig. Male tail ray and spicule defects. Males do not mate. About 50% larval lethality. H and B cell lineage defects. Received new stock Jan. 2006.
CZ3464 juIs176. C. elegans juIs176 [IFB-1a::GFP + rol-6(su1006)]. Some worms don't roll. GFP expression patterns are similar to MH4 staining.
CZ375 vab-1(e856) II. C. elegans
CZ3761 ptp-3(mu256) II. C. elegans Low penetrance tail Vab and embryonic lethality.
CZ401 vab-19(e1036) II. C. elegans Cold sensitive lethal. Vab at 20 and 25C.
CZ4019 juEx595. C. elegans juEx595 [IFB-1b::GFP + rol-6(su1006)]. Maintain by picking Rollers. GFP expression patterns are similar to MH4 staining. Maintain by picking rollers.
CZ414 vab-1(e699) II. C. elegans Intermediate Vab-1 phenotype. About 9% embryonic lethality and about 20% larval lethality. CB699 outcrossed 2X to N2 to make CZ414.
CZ419 dapk-1(ju4) I. C. elegans Abnormal head morphology, slightly temperature sensitive. Maintain under normal conditions. Reference: Tong A, et al. Proc Natl Acad Sci U S A. 2009 Feb 3;106(5):1457-61.
CZ4213 mkk-4(ju91) X. C. elegans Suppressor of rpm-1.
CZ4280 eps-8(jc36)/unc-26(e205) dpy-4(e1166) IV. C. elegans Heterozygotes segregate wild-type heterozygotes, Emb, and Unc Dpy. Maintain by picking wild-type.
CZ429 vab-1(ju8) II. C. elegans
CZ4380 ifb-1(ju71) II. C. elegans Incompletely penetrant embryonic lethal at three-fold. Mild Mua. Abberant head epidermal morphology. PKA vab-21.
CZ4733 spon-1(ju430) II. C. elegans Temperature-sensitive. Maintain at 15C. Vab. Lethal at 25C. 2-fold Lpy. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.
CZ4734 spon-1(e2623) II. C. elegans Maintain under normal conditions. Weak bent head. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.
CZ5261 juIs198 V. C. elegans juIs198 [unc-25p::YFP::rab-5 + ttx-3p::RFP] V. YFP-labeled RAB-5 synaptic vesicles in GABAergic motor neurons. Reference: Sann SB, Crane MM, Lu H, Jin Y. PLoS One. 2012;7(6):e37930.
CZ540 ptp-3(op147) II. C. elegans Low penetrance tail vab (3-5%). Low penetrance embryonic lethality (3-5%). Low penetrance larval lethality (3%).
CZ5686 vab-1(e2027) ptp-3(mu256)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.
CZ5730 dlk-1(ju476) I. C. elegans Suppressor of rpm-1.
CZ5847 spon-1(ju402) II; juEx1111. C. elegans juEx1111 [spon-1::vGFP]; rescues ju402 lethality. Vab. 2-fold Lpy. ju402 is lethal. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.
CZ631 juIs14 IV. C. elegans juIs14 [acr-2p::GFP + lin-15(+)] IV. GFP expression in cholinergic motor neurons. Reference: Hallam SJ, et al. Development. 2000 Oct;127(19):4239-52.
CZ7112 lin-31(n301) vab-1(e2027) II. C. elegans Muv.
CZ7575 ebax-1(ju699) IV; juEx1434. C. elegans juEx1434 [rgef-1p::ebax-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. juEx1434 rescues Egl of pqn-55(ju699) mutants. Reference: Wang Z., et al. Neuron. 2013 Sep 4;79(5):903-16.
CZ793 vab-1(e2027) II; lin-15B&lin-15A(n765) X; juIs24. C. elegans juIs24 [vab-1::GFP + lin-15(+)]. GFP very faint. Overtly WT.
CZ8332 juIs223 IV. C. elegans juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. Transcriptional reporter with ttr-39 promoter driving mCherry expression in DD and VD neurons. Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.
CZ8920 cebp-1(tm2807) X. C. elegans Superficially wild-type. Strong defects in axon regeneration. Maintain under normal conditions. Reference: Yan D, et al. Cell. 2009 Sep 4;138(5):1005-18.
CZ900 syd-2(ju37) X. C. elegans Moderately Egl, Unc.
CZ910 vab-1(e2027) II. C. elegans vab-1 null phenotype. e2027 is a 74 bp deletion allele.
CZ9236 juIs252 V. C. elegans juIs252 [mec-4p::mCherry + ttx-3p::RFP] V. mCherry expression in touch neurons. Reference: Knowlton WM, et al. Front Neurosci. 2017 May 10;11:263. doi: 10.3389/fnins.2017.00263. Chuang M, et al. 2014 Cell Rep, 9, 874-83.
CZ9676 acr-2(n2595 n2420) X. C. elegans Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.
CZ9912 ebax-1(ju699) IV. C. elegans Mild Unc and Egl. Reference: Wang Z., et al. Neuron. 2013 Sep 4;79(5):903-16.
CZ9957 gtl-2(n2618) IV. C. elegans Maintain under normal conditions. Reference: Stawicki TM, et al. Curr Biol. 2011 May 24;21(10):883-8.
CZ996 juIs52. C. elegans juIs52 [vab-2::GFP + rol-6(su1006)]. Rescuing GFP-tagged VAB-2 transgene. Rollers. vab-2 formerly known as efn-1.
MT6241 acr-2(n2420) X. C. elegans Gain-of-function allele. Spontaneous shrinker, jerky, Unc. G925A, V309M in the pore lining domain. References: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. Stawicki TM, et al. Curr Biol. 2011 May 24;21(10):883-8.
MT6550 lam-3(n2561)/dpy-5(e61) unc-75(e950) I. C. elegans Heterozygotes are WT. Segregate Dpy Uncs. Segregate L1 lethal: starved, uncoordinated, defective pharyngeal basement membrane.
XA2262 gcy-33(ok232) V; gcy-31(ok296) X; qaIs2241. C. elegans qaIs2241 [gcy-36p::egl-1 + gcy-35p::GFP]; causes genetic ablation of AQR, PQR, and URX neurons. Some residual neurons in the tail remain GFP+ from the gcy-35::GFP transgene.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
ju41 Allele substitution nonsense
ju29 Allele substitution splice_site
ju39 Allele
ju142 Allele
ju82 Allele substitution
ju156 Allele deletion frameshift
ju160 Allele substitution
ju1154 Allele deletion
ju145 Allele substitution nonsense
ju1 Allele substitution nonsense
ju146 Allele substitution
ju468 Allele substitution nonsense
ju4 substitution
ju91 Allele
ju8 Allele substitution
ju71 Allele deletion
ju430 Allele substitution
ju476 Allele insertion frameshift
ju402 Allele substitution nonsense
ju37 Allele