Laboratory Information
| Name | CZ View on WormBase |
|---|---|
| Allele designation | ju |
| Head | Andrew D Chisholm |
| Institution | University of California, San Diego, CA |
| Address | 9500 Gilman Dr. MC0368 Bonner Hall 2429 La Jolla 92092 United States |
| Website | http://www-biology.ucsd.edu/faculty/chisholm.html |
| Gene classes | cebp cnd col dapk ephx ifa ifb ifc max mcrs ptrn spon syd sydn tbc ubr vac bgal ebax fbxl mctp supr lhrp mfsd |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| CZ10123 | rabx-5(qa7800) III. | C. elegans | rabx-5(qa7800) mutants show decreased protein localization of YFP::RAB-5 in the cell bodies but increased protein localization within the dorsal cord in both synaptic and intersynaptic regions |
| CZ10175 | zdIs5 I. | C. elegans | zdIs5 [mec-4p::GFP + lin-15(+)] I. SK4005 was outcrossed 10x to produce this strain. |
| CZ11771 | nsf-1(ty10) I; muIs32 II. | C. elegans | muIs32 [mec-7p::GFP + lin-15(+)]. Egl, semi-Sterile, embryonic & larval lethality. Lethal in trans to Df. Defective fusion of anchor cell to uterine seam. Maintain under normal conditions. Reference: Choi J, et al., Dev Biol. 2006 Sep 1;297(1):87-102. |
| CZ1251 | rpm-1(ju41) V. | C. elegans | WT in movement. Abnormal synapses at GABAergic NMJs. |
| CZ13799 | juIs76 II. | C. elegans | juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. [NOTE: (10/11/2018) CZ13799 was sent as a replacement for CZ1200, which was found to carry background mutations affecting neuron morphology.] Derived by outcrossing CZ1200 to remove lin-15(n765) and unidentified background mutations. Reference (for original juIs76 strain): Huang X, et al. Neuron. 2002 May 16;34(4):563-76. |
| CZ13896 | juIs319. | C. elegans | juIs319 [col-19p::GCaMP3 + col-19p::tdTomato]. col-19p::GCaMP3 expression is induced by either laser or needle wounding. col-19 is an adult-specific collagen and is not expressed until the end of the L4 larval stage. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7. |
| CZ1455 | cnd-1(ju29) III. | C. elegans | Reverse kinker. |
| CZ14748 | juIs352. | C. elegans | juIs352 [col-19p::GFP::moesin]. GFP::moesin expression labels F-actin by fusing GFP to sequences that encoded the C-terminal end of the sole Drosophila MER homolog, moesin. The F-actin ring (GFP::moesin) is induced upon needle wounding. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7. |
| CZ1566 | lin-15B&lin-15A(n765) juIs109 X. | C. elegans | juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510. |
| CZ16143 | juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. | C. elegans | juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. RFP expression in AIY neuron. Weak light green signals were observed in the neurons using compound scope although this is only the former half of the split GFP. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376. |
| CZ1632 | juIs76 II; max-1(ju39) V. | C. elegans | juIs76 [unc-25p::GFP + lin-15(+)] II. Very mild Unc. |
| CZ17515 | juSi94 II; rps-18(ok3353) IV. | C. elegans | juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. |
| CZ1758 | juIs76 II; max-1(ju142) V. | C. elegans | juIs76 [unc-25p::GFP + lin-15(+)] II. Very mild Unc. |
| CZ1774 | vab-1(e856) ptp-3(op147)/mIn1 [mIs14 dpy-10(e128)] II. | C. elegans | mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53. |
| CZ18018 | juSi94 II; rps-18(ok3353) IV; juEx5375. | C. elegans | juSi94 [rps-18p::GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5375 [col-19p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. Expression of split GFP reporter labels ribosomes in the epidermis. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376. |
| CZ18020 | juSi94 II; rps-18(ok3353) IV; juEx5377. | C. elegans | juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5377 [myo-3p::GFP1-10 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. Muscle-specific expression of split GFP reporter allows visualization of ribosomes in muscle. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. |
| CZ18058 | juSi103. | C. elegans | juSi103 [col-19p::mito::GCaMP5]. GCaMP5 reporter labels hypodermal mitochondria. Reference: Xu S & Chisholm AD. Dev Cell. 2014 Oct 13;31(1):48-60. doi: 10.1016/j.devcel.2014.08.002. PMID: 25313960. |
| CZ18412 | juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. | C. elegans | juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. |
| CZ18423 | juEx5375. | C. elegans | juEx5375 [col-19p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376. |
| CZ18550 | juSi123 II; rpl-29(tm3555) IV. | C. elegans | juSi123 [rpl-29::GFP] II. Strong GFP signal allowing visualization of ribosomes. GFP inserted at C-terminus of RPL-29. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. |
| CZ18637 | juSi83 II; rps-18(ok3353) IV/nT1[qIs51] (IV;V). | C. elegans | juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. |
| CZ1893 | syd-1(ju82) II. | C. elegans | Egl. Coiler when moving backwards. Recessive. F35D2.5 |
| CZ18975 | juIs338. | C. elegans | juIs338 [mec-4p::ebp-2::GFP + ttx-3p::RFP]. Derived by integration of array in parental strain CZ12264. Reference: Ghosh-Roy A, et al. Dev Cell. 2012 Oct 16;23(4):716-28. Chen L, et al. Elife. 2015 Sep 4;4. doi: 10.7554/eLife.08695. |
| CZ19297 | juSi94 II; rps-18(ok3353) juIs409 IV. | C. elegans | juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. |
| CZ1931 | juIs76 II; unc-71(ju156) III. | C. elegans | juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. |
| CZ1935 | juIs76 II; unc-71(ju160) III. | C. elegans | juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. |
| CZ19982 | mcu-1(ju1154) IV. | C. elegans | Superficially wild-type. No uptake of calcium in mitochondria after wounding. Reference: Xu S, Chisholm AD. Dev Cell. 2014 Oct 13; 31:48-60. |
| CZ20132 | juSi94 II; rps-18(ok3353) IV; juIs463. | C. elegans | juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. DD motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in those neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. |
| CZ20215 | tba-1(ju89) I. | C. elegans | Gain-of-function allele isolated sem-4; juIs1 screen in 1997. ju89 has slightly semi-dominant effects, and the gf phenotype is most obvious in homozygous. This outcrossed strain does not carry a sem-4 mutation or juIs1. References: Kurup N, et al. Curr Biol. 2015 Jun 15;25(12):1594-605. Kurup N, et al. PLoS Genet. 2017 Jun 21;13(6):e1006844. |
| CZ20310 | juSi164 unc-119(ed3) III. | C. elegans | juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. Maintain in the covered box to avoid unnecessary exposure to ambient light. Wild-type behavior in movement, mating, growth and brood size. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Wild-type behavior in movement, mating, growth and brood size. MosSCI insertion into oxTi444 on Chr. III. Reference: Noma K & Jin Y. Nature Communications, 2015. |
| CZ22695 | juEx6908. | C. elegans | juEx6908 [nmr-1p::PH::miniSOG(Q103L) + nmr-1p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Interneuron expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. |
| CZ22698 | juEx6911. | C. elegans | juEx6911 [unc-25p::PH::miniSOG(Q103L) + unc-25p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in GABAergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. |
| CZ22703 | juEx6916. | C. elegans | juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. |
| CZ22714 | miro-3(ju1310) juSi271 I; miro-1(ju1306) IV; miro-2(ju1309) X. | C. elegans | juSi271 [col-19p::mito::Dendra2]. Superficially wild-type with altered mitochondrial morphology. Fluorescent reporter labels hypodermal mitochondria. Reference: Xu S, et al. J Genet Genomics. 2016 Feb 20;43(2):103-6. |
| CZ23277 | juEx7101. | C. elegans | juEx7101 [col-19p::PH::miniSOG(Q103L) + ttx-3::RFP]. Pick RFP+ to maintain. Adult epidermal expression of PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. |
| CZ23279 | juEx7103. | C. elegans | juEx7103 [unc-17p(beta)::PH::miniSOG(Q103L) + acr-2p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in cholinergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. [NOTE: strain was previously described as carrying ttx-3::GFP, but appears to be ttx-3::RFP instead.] |
| CZ23281 | juEx7105. | C. elegans | juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. |
| CZ24092 | gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. | C. elegans | ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826. |
| CZ24274 | dhc-1(lt45[dhc-1::GFP]) I; ltSi953 II; unc-119(ed3) III. | C. elegans | ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826. |
| CZ2475 | juIs145 II. | C. elegans | juIs145 [flp-13p::GFP + lin-15(+)] II. GFP expression in ASE, ASG, ASK, I5 and DD1-DD6. Reference: Wu Z, et al. Proc Natl Acad Sci USA. 2007 Sep 18;104(38):15132-7. PMID: 17848506. |
| CZ2485 | ahr-1(ju145) I. | C. elegans | |
| CZ24969 | sphk-1(ju831) II. | C. elegans | Aldicarb resistant. Reference: McCulloch KA, et al. G3 (Bethesda). 2017 Jul 5;7(7):2055-2063. |
| CZ24990 | unc-44(ju1412[unc-44::GFP]) IV. | C. elegans | Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707. |
| CZ25013 | unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. | C. elegans | unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707. |
| CZ252 | itr-1(n2559)/lin-45(n2018) unc-24(e138) IV. | C. elegans | Heterozygotes are WT and segregate WT, Unc Lins and very slow growing constipated worms. n2559 is a null allele of itr-1. |
| CZ25708 | prg-1(ju1574) I. | C. elegans | Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014. |
| CZ26389 | esyt-2(ju1408) III. | C. elegans | CRISPR-engineered deletion of esyt-2 from middle of 5'UTR to middle of 3'UTR using guide RNAs crCP01 (GGTTTCAGTAATTGTGGGCT) and crCP02 (GTGCACTTACGGGTTGTAGG). Superficially wild-type. Reference: Piggott CA, et al. Genetics. 2021 Apr 19;iyab063. doi: 10.1093/genetics/iyab063. PMID: 33871019. |
| CZ26494 | juSi364 IV; acr-2(n2420) X. | C. elegans | juSi364 [unc-17Bp::3xFLAG::eif-3.g::SL2::GFP] IV. GFP expression in cholinergic motor neurons. Convulsing worms. Strain is suitable for neuron-type eCLIP. Reference: Blazie S, et al. Elife. 2021 Jul 29;10:e68336. PMID: 34323215. |
| CZ26606 | vwa-8(ju1659) X. | C. elegans | Superficially wild-type. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263 |
| CZ26660 | micu-1(ju1155) IV/nT1 [qIs51] (IV;V). | C elegans | Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP micu-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061. |
| CZ2744 | adm-4(ok265) X. | C. elegans | Wild type. |
| CZ27508 | micu-1(ju1783[micu-1::gfp]) IV. | C elegans | GFP reporter inserted into C-terminus of endogenous micu-1 locus. Diffuse GFP signals throughout the body. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061. |
| CZ27748 | vwa-8(ju1799[vwa-8::GFP::3xFLAG]) X. | C. elegans | Endogenous vwa-8 locus tagged with GFP and 3xFLAG. VWA-8::GFP is expressed in mitochondria of hypodermis, intestine, and muscle, but not detectable in neurons. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263. |
| CZ29001 | muIs32 II; degt-1(ok3307) V. | C. elegans | muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.] |
| CZ3011 | unc-16(ju146) III. | C. elegans | Uncoordinated and egg-laying defective. T to C transition resulting in L75P. |
| CZ3086 | kin-1(ok338)/unc-54(r293) I. | C. elegans | Heterozygotes are WT and segregate WT, Unc, and early larval lethal. |
| CZ3103 | juIs167. | C. elegans | juIs167 [vab-19::GFP + rol-6(su1006)]. Integrated by UV/TMP. Rollers. Received new stock Feb 2005. |
| CZ333 | juIs1 IV. | C. elegans | juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82. |
| CZ337 | vab-1(dx31) II. | C. elegans | Strong Vab-1 phenotype. About 50% embryonic lethality and about 30% larval lethality. Genetic null. |
| CZ3391 | vab-3(ju468) X. | C. elegans | Vab. Notched Head. Distal tip cell Mig. Male tail ray and spicule defects. Males do not mate. About 50% larval lethality. H and B cell lineage defects. Received new stock Jan. 2006. |
| CZ3464 | juIs176. | C. elegans | juIs176 [IFB-1a::GFP + rol-6(su1006)]. Some worms don't roll. GFP expression patterns are similar to MH4 staining. |
| CZ375 | vab-1(e856) II. | C. elegans | |
| CZ3761 | ptp-3(mu256) II. | C. elegans | Low penetrance tail Vab and embryonic lethality. |
| CZ401 | vab-19(e1036) II. | C. elegans | Cold sensitive lethal. Vab at 20 and 25C. |
| CZ4019 | juEx595. | C. elegans | juEx595 [IFB-1b::GFP + rol-6(su1006)]. Maintain by picking Rollers. GFP expression patterns are similar to MH4 staining. Maintain by picking rollers. |
| CZ414 | vab-1(e699) II. | C. elegans | Intermediate Vab-1 phenotype. About 9% embryonic lethality and about 20% larval lethality. CB699 outcrossed 2X to N2 to make CZ414. |
| CZ419 | dapk-1(ju4) I. | C. elegans | Abnormal head morphology, slightly temperature sensitive. Maintain under normal conditions. Reference: Tong A, et al. Proc Natl Acad Sci U S A. 2009 Feb 3;106(5):1457-61. |
| CZ4213 | mkk-4(ju91) X. | C. elegans | Suppressor of rpm-1. |
| CZ4280 | eps-8(jc36)/unc-26(e205) dpy-4(e1166) IV. | C. elegans | Heterozygotes segregate wild-type heterozygotes, Emb, and Unc Dpy. Maintain by picking wild-type. |
| CZ429 | vab-1(ju8) II. | C. elegans | |
| CZ4380 | ifb-1(ju71) II. | C. elegans | Incompletely penetrant embryonic lethal at three-fold. Mild Mua. Abberant head epidermal morphology. PKA vab-21. |
| CZ4733 | spon-1(ju430) II. | C. elegans | Temperature-sensitive. Maintain at 15C. Vab. Lethal at 25C. 2-fold Lpy. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56. |
| CZ4734 | spon-1(e2623) II. | C. elegans | Maintain under normal conditions. Weak bent head. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56. |
| CZ5261 | juIs198 V. | C. elegans | juIs198 [unc-25p::YFP::rab-5 + ttx-3p::RFP] V. YFP-labeled RAB-5 synaptic vesicles in GABAergic motor neurons. Reference: Sann SB, Crane MM, Lu H, Jin Y. PLoS One. 2012;7(6):e37930. |
| CZ540 | ptp-3(op147) II. | C. elegans | Low penetrance tail vab (3-5%). Low penetrance embryonic lethality (3-5%). Low penetrance larval lethality (3%). |
| CZ5686 | vab-1(e2027) ptp-3(mu256)/mIn1 [mIs14 dpy-10(e128)] II. | C. elegans | mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53. |
| CZ5730 | dlk-1(ju476) I. | C. elegans | Suppressor of rpm-1. |
| CZ5847 | spon-1(ju402) II; juEx1111. | C. elegans | juEx1111 [spon-1::vGFP]; rescues ju402 lethality. Vab. 2-fold Lpy. ju402 is lethal. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56. |
| CZ631 | juIs14 IV. | C. elegans | juIs14 [acr-2p::GFP + lin-15(+)] IV. GFP expression in cholinergic motor neurons. Reference: Hallam SJ, et al. Development. 2000 Oct;127(19):4239-52. |
| CZ7112 | lin-31(n301) vab-1(e2027) II. | C. elegans | Muv. |
| CZ7575 | ebax-1(ju699) IV; juEx1434. | C. elegans | juEx1434 [rgef-1p::ebax-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. juEx1434 rescues Egl of pqn-55(ju699) mutants. Reference: Wang Z., et al. Neuron. 2013 Sep 4;79(5):903-16. |
| CZ793 | vab-1(e2027) II; lin-15B&lin-15A(n765) X; juIs24. | C. elegans | juIs24 [vab-1::GFP + lin-15(+)]. GFP very faint. Overtly WT. |
| CZ8332 | juIs223 IV. | C. elegans | juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. Transcriptional reporter with ttr-39 promoter driving mCherry expression in DD and VD neurons. Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. |
| CZ8920 | cebp-1(tm2807) X. | C. elegans | Superficially wild-type. Strong defects in axon regeneration. Maintain under normal conditions. Reference: Yan D, et al. Cell. 2009 Sep 4;138(5):1005-18. |
| CZ900 | syd-2(ju37) X. | C. elegans | Moderately Egl, Unc. |
| CZ910 | vab-1(e2027) II. | C. elegans | vab-1 null phenotype. e2027 is a 74 bp deletion allele. |
| CZ9236 | juIs252 V. | C. elegans | juIs252 [mec-4p::mCherry + ttx-3p::RFP] V. mCherry expression in touch neurons. Reference: Knowlton WM, et al. Front Neurosci. 2017 May 10;11:263. doi: 10.3389/fnins.2017.00263. Chuang M, et al. 2014 Cell Rep, 9, 874-83. |
| CZ9676 | acr-2(n2595 n2420) X. | C. elegans | Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. |
| CZ9912 | ebax-1(ju699) IV. | C. elegans | Mild Unc and Egl. Reference: Wang Z., et al. Neuron. 2013 Sep 4;79(5):903-16. |
| CZ9957 | gtl-2(n2618) IV. | C. elegans | Maintain under normal conditions. Reference: Stawicki TM, et al. Curr Biol. 2011 May 24;21(10):883-8. |
| CZ996 | juIs52. | C. elegans | juIs52 [vab-2::GFP + rol-6(su1006)]. Rescuing GFP-tagged VAB-2 transgene. Rollers. vab-2 formerly known as efn-1. |
| MT6241 | acr-2(n2420) X. | C. elegans | Gain-of-function allele. Spontaneous shrinker, jerky, Unc. G925A, V309M in the pore lining domain. References: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. Stawicki TM, et al. Curr Biol. 2011 May 24;21(10):883-8. |
| MT6550 | lam-3(n2561)/dpy-5(e61) unc-75(e950) I. | C. elegans | Heterozygotes are WT. Segregate Dpy Uncs. Segregate L1 lethal: starved, uncoordinated, defective pharyngeal basement membrane. |
| XA2262 | gcy-33(ok232) V; gcy-31(ok296) X; qaIs2241. | C. elegans | qaIs2241 [gcy-36p::egl-1 + gcy-35p::GFP]; causes genetic ablation of AQR, PQR, and URX neurons. Some residual neurons in the tail remain GFP+ from the gcy-35::GFP transgene. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| ju41 | Allele | substitution | nonsense |
| ju29 | Allele | substitution | splice_site |
| ju39 | Allele | ||
| ju142 | Allele | ||
| ju82 | Allele | substitution | |
| ju156 | Allele | deletion | frameshift |
| ju160 | Allele | substitution | |
| ju1154 | Allele | deletion | |
| ju145 | Allele | substitution | nonsense |
| ju1 | Allele | substitution | nonsense |
| ju146 | Allele | substitution | |
| ju468 | Allele | substitution | nonsense |
| ju4 | substitution | ||
| ju91 | Allele | ||
| ju8 | Allele | substitution | |
| ju71 | Allele | deletion | |
| ju430 | Allele | substitution | |
| ju476 | Allele | insertion | frameshift |
| ju402 | Allele | substitution | nonsense |
| ju37 | Allele |