Laboratory Information

NameCX View on WormBase
Allele designationky
HeadCornelia Bargmann
InstitutionRockefeller University, New York, NY
Address 1230 York Ave
Bargmann Lab
Box 204
New York 10065
United States
Website http://www.rockefeller.edu/labheads/bargmann/index.php
Gene classes adp  bad  calf  dyn  glr  hmbx  hot  npr  nsy  ocr  odr  sad  sax  slt 
sra  srb  srd  sre  srg  sro  str  syg  inpp 

Strains contributed by this laboratory

Strain Genotype Species Description
CX1 odr-6(ky1) II. C. elegans
CX10 osm-9(ky10) IV. C. elegans diac-.
CX10207 calf-1(ky867) V. C. elegans Saheki Y, Bargmann CI. Nat Neurosci. 2009 Oct;12(10):1257-65.
CX11400 kyIR9 (X: ~4745910 - ~4927296, N2>CB4856) X. C. elegans kyIR9 [X: ~4745910 - ~4927296, N2>CB4856] X. LG X contains N2 from ~4745910 - ~4927296; the rest is from CB4856. QX9 was crossed to CB4856; a recombinant F2 with N2 npr-1 and CB4856 tyra-3 was isolated. Its progeny was back-crossed to CB4856 8 times, picking npr-1 hets each round prior to homozygosing.
CX11839 tyra-3(ok325) X. C. elegans Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX12708 ggr-2(lf62) X. C. elegans Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX12709 avr-14(ad1302) I. C. elegans Decreased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX12724 acc-4(ok2371) III. C. elegans Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX12725 inx-20(ok681) I. C. elegans Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX12726 inx-9(ok1502) IV. C. elegans Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX12800 ser-3(ad1774) I. C. elegans Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX13079 octr-1(ok371) X. C. elegans Derived by outcrossing VC224 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX13111 dop-5(ok568) V. C. elegans Derived by outcrossing RB785 three times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX13325 inx-2(ok376) X. C. elegans Derived by outcrossing VC260 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX14295 pdfr-1(ok3425) III. C. elegans Decreased locomotion on food. Derived by outcrossing VC2609 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX14394 npr-5(ok1583) V. C. elegans Derived by outcrossing RB1393 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX17256 kyIs722. C. elegans kyIs722 [str-2p::GCaMP5(D380Y) + elt-2::mCherry]. GCaMP5a expression driven by str-2 promoter, providing a very bright integrated calcium indicator useful for imaging of AWC(on).
CX188 dig-1(ky188) III; kyIs4 X. C. elegans kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX20 adp-1(ky20) II. C. elegans Defective in adaptation to a subset of AWC-sensed odorants. Dominant.
CX2065 odr-1(n1936) X. C. elegans Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol.
CX2205 odr-3(n2150) V. C. elegans Defective chemotaxis to many volative odorants. Defective osmotic avoidance (osm). Defective chemotaxis to some water-soluble attractants (che).
CX2304 odr-2(n2145) V. C. elegans Defective chemotaxis to some volatile odorants: benzaldehyde, isoamyl alcohol.
CX2357 odr-5(ky9) X. C. elegans Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. Linked sterility has not been separated from Odr phenotype.
CX2386 odr-8(ky31) IV. C. elegans
CX2398 odr-8(ky41) IV. C. elegans
CX2565 kyIs4 lin-15B&lin-15A(n765) X. C. elegans kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX2610 lin-15B&lin-15A(n765) kyIs30 X. C. elegans kyIs30 [glr-1::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX2914 nDf16/dpy-17(e164) unc-32(e189) III. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. The DpyUncs will outgrow the hets.
CX2993 sax-7(ky146) IV; kyIs4 X. C. elegans kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3019 mut-2(r459) I; dpy-19(n1347) glr-1(ky176) III. C. elegans Nose touch defective (recessive). Mechanosensory defective (semi-dominant). Mildly Dpy (ts).
CX3125 sax-6(ky214) I; kyIs4 X. C. elegans kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-6 is temperature sensitive. Posterior axon from amphid neuron. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3137 sax-9(ky212) IV; kyIs4 X. C. elegans kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-9 is temperature senstive. Amphid axon guidance defects (termination, guidance). This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3171 sax-3(ky200) X. C. elegans Defective in the axon guidance of neurons. Maintain at 20C or 25C.
CX3198 sax-3(ky123) X. C. elegans sax-3 mutants have an anteriorly-displaced nerve ring, defects in axon guidance to the ventral midline, and extra axon crossing at the ventral midline. There are also defects in CAN and HSN cell migration, a notched head and an Egl phenotype. This allele is 80% lethal in embryonic stages. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX32 odr-10(ky32) X. C. elegans Impaired chemotaxis to low concentrations of the odorant diacetyl.
CX3222 odr-3(n1605) V. C. elegans Reference: Roayaie K, et al. Neuron. 1998 Jan;20(1):55-67.
CX3260 kyIs37 II. C. elegans kyIs37 [odr-10::GFP + lin-15(+)] II. No lin-15 mutation in background. Translational fusion; first few amino acids of odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3344 kyIs53 X. C. elegans kyIs53[odr-10::GFP]. Full length odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3385 sax-2(ky216) III. C. elegans Temperature sensitive. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3410 odr-10(ky225) X. C. elegans Impaired chemotaxis to low concentrations of the odorant diacetyl. ky225 is a 1351 bp deletion removing all coding sequence past the N-terminal 120 amino acids.
CX3465 kyIs39. C. elegans kyIs39 [sra-6::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3493 sax-5(ky118) IV. C. elegans Amphid axon guidence defect. HSN axon guidence defect. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3553 lin-15B&lin-15A(n765) kyIs104 X. C. elegans kyIs104 [str-1p::GFP] X. AWB expression of GFP.
CX3572 kyIs105 V; lin-15B&lin-15A(n765) X. C. elegans kyIs105 [str-3p::snb-1::GFP + lin-15(+)]. Also known as str-3::VAMP::GFP or ASI::VAMP::GFP or M7::VAMP::GFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3596 kyIs128 lin-15B&lin-15A(n765) X. C. elegans kyIs128 [str-3::GFP + lin-15(+)]. kyIs128 encodes a translational fusion contaning 4aa coding sequence (M7.13::GFP). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3695 kyIs140 I. C. elegans kyIs140 [str-2::GFP + lin-15(+)] I. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3716 lin-15B&lin-15A(n765) kyIs141 X. C. elegans kyIs141[osm-9::GFP5 + lin-15(+)]. GFP in sensory neurons.
CX3877 kyIs156 X. C. elegans kyIs156 [str-1p::odr-10(cDNA)::GFP]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3933 kyIs140 I; slo-1(ky389) V. C. elegans kyIs140 [str-2::GFP + lin-15(+)]. ky389 is semi-dominant. str-2::GFP is expressed in both AWC neurons in ky389 mutants. PKA nsy-3(ky389).
CX3937 lim-4(ky403) X. C. elegans Coily movement; aberrent head movement. The AWB neurons are transformed towards the AWC neuron fate by many criteria.
CX3940 kyIs140 I; rol-6(e187) II; slo-1(ky399) V. C. elegans kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX4 odr-7(ky4) X. C. elegans odr-7 mutants fail to respond to odorants sensed by the AWA neurons.
CX4103 kyIs150 IV; sax-1(ky491) X. C. elegans kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX4148 npr-1(ky13) X. C. elegans
CX4533 ocr-1(ok132) V. C. elegans Double mutants with ocr-2 have reduced AWA gene expression.
CX4534 ocr-1(ak46) V. C. elegans Double mutants with ocr-2 have reduced AWA gene expression. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX4544 ocr-2(ak47) IV. C. elegans Chemosensory, mechanosensory, and osmosensory defects. Null allele. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX4828 kyIs140 I; tir-1(ky388) III; him-5(e1490) V. C. elegans kyIs140 [str-2::GFP + lin-15(+)] I. Him. In tir-1 mutants str-2::GFP is expressed in both AWC neurons.
CX4998 kyIs140 I; nsy-1(ky397) II. C. elegans kyIs140 [str-2::GFP + lin-15(+)] I. In nsy-1 mutants str-2::GFP is expressed in both AWC neurons.
CX5000 slt-1(eh15) X. C. elegans slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant.
CX5156 sad-1(ky289) X. C. elegans
CX5346 slt-1(ev740) X. C. elegans AVM axon guidance defect.
CX5347 slt-1(ev741) X. C. elegans AVM axon guidance defect.
CX5463 slt-1(ok255) X. C. elegans Viable. Can be scored only using special neuronal markers such as zdIs5, which labels the touch cells and shows that they have aberrant anterior processes in the slt-1 mutant.
CX5478 lin-15B&lin-15A(n765) X; kyEx581. C. elegans kyEx581 [ocr-4::GFP + lin-15(+)]. GFP expression in OLQS. Maintain by picking non-Muv.
CX5757 kyIs140 I; nsy-4(ky616) IV. C. elegans kyIs140 [str-2::GFP + lin-15(+)] I. 2-AWC OFF.
CX5893 kyIs140 I; ceh-36(ky646) X. C. elegans kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-36 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX5922 kyIs140 I; ceh-36(ky640) X. C. elegans kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-26 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX5974 kyIs262 IV. C. elegans kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV.
CX6161 inx-19(ky634) I. C. elegans Previously called nsy-5.
CX6391 syg-2(ky671) X. C. elegans Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Originally had kyEx648 [unc-86 + syg-1::GFP] in this strain, but the CGC stock does not contain the array.
CX6448 gcy-35(ok769) I. C. elegans 668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'.
CX652 kyIs235 V; syg-1(ky652) X. C. elegans kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX6632 kyEx728. C. elegans kyEx728 [sra-6p::G-CaMP]. No co-injection marker -- pick GFP+ animals to maintain.
CX6827 eat-4(ky5) III; kyEx844. C. elegans kyEx844 contains [odr-3::eat-4 + elt-2::GFP].
CX7102 lin-15B&lin-15A(n765) qaIs2241X. C. elegans qaIs2241 [gcy-36::egl-1 + gcy-35::GFP + lin-15(+)].
CX9683 gcy-31(ok296) X; kyEx2116. C. elegans kyEx2116 contains [gcy-31::SL2::GFP + odr-1::DsRed2].
CZ3714 gcy-31(ok296) X. C. elegans 2505bp deletion in cosmid T07D1. Break points are 6562 and 9069 with respect to T07D1. Sequence at the break point is: GGAAAAAAAAACTTCGCG / TTTGGCTAGTCGTAT. Primers: ok296u1: CTGAAACCATCTGACAGA; ok296d1: CATCGGAATAGGATTGTTG; ok296d2: CATTAGGTTTACAGGCTTAG. ok296d1u1 = 290bp product with WT allele. ok296d2u1 = 352 bp product with ok296 allele.
CZ3715 gcy-33(ok232) V. C. elegans 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.
MT5300 odr-4(n2144) III. C. elegans Defective chemotaxis to some volatile odorants: benzaldehyde, diacetyl,2,4,5-trimethyl thiazole. Chemotaxis defect is temperature sensitive.
TL24 zdIs5 I; clr-1(cy14) II; slt-1(eh15) X. C. elegans zdIs5 [mec-4::GFP + lin-15(+)]. cy14 was isolated in a screen for suppressors of the AVM axon ventral guidance defect of slt-1 null mutant. cy14 is a G-to-A transition in the splice acceptor of intron 5 of clr-1 that leads to the use of a cryptic splice acceptor and consequently to an 18 bp deletion in exon 6.
WE5236 pgIR1 (I, CB4856>N2) I. C. elegans pgIR1 (I, CB4856>N2). CB4856 Chromosome I in N2 background.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
ky1018 Allele substitution nonsense
ky1 Allele
ky10 Allele
ky867 Allele substitution nonsense
ky188 Allele
ky20 Allele substitution
ky9 Allele
ky31 Allele substitution
ky41 Allele
ky146 Allele substitution nonsense
ky176 Allele
ky214 Allele
ky212 Allele
ky200 Allele
ky123 Allele
ky32 Allele
ky216 Allele substitution nonsense
ky225 Allele
ky118 Allele
ky275 Allele
ky389 Allele substitution
ky403 Allele substitution nonsense
ky399 Allele substitution
ky4 Allele substitution nonsense
ky211 Allele
ky13 Allele substitution nonsense
ky388 Allele substitution nonsense
ky397 Allele substitution nonsense
ky51 Allele substitution
ky289 Allele substitution
ky616 Allele substitution
ky646 Allele substitution nonsense
ky640 Allele substitution nonsense
ky634 Allele substitution
ky671 Allele substitution
ky652 Allele deletion frameshift
ky5 Allele deletion
ky535 Allele
ky651 Allele substitution splice_site