Laboratory Information
| Name | CX View on WormBase |
|---|---|
| Allele designation | ky |
| Head | Cornelia Bargmann |
| Institution | Rockefeller University, New York, NY |
| Address | 1230 York Ave Bargmann Lab Box 204 New York 10065 United States |
| Website | http://www.rockefeller.edu/labheads/bargmann/index.php |
| Gene classes | adp bad calf dyn glr hmbx hot npr nsy ocr odr sad sax slt sra srb srd sre srg sro str syg inpp |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| CX1 | odr-6(ky1) II. | C. elegans | |
| CX10 | osm-9(ky10) IV. | C. elegans | diac-. |
| CX10207 | calf-1(ky867) V. | C. elegans | Saheki Y, Bargmann CI. Nat Neurosci. 2009 Oct;12(10):1257-65. |
| CX11400 | kyIR9 (X: ~4745910 - ~4927296, N2>CB4856) X. | C. elegans | kyIR9 [X: ~4745910 - ~4927296, N2>CB4856] X. LG X contains N2 from ~4745910 - ~4927296; the rest is from CB4856. QX9 was crossed to CB4856; a recombinant F2 with N2 npr-1 and CB4856 tyra-3 was isolated. Its progeny was back-crossed to CB4856 8 times, picking npr-1 hets each round prior to homozygosing. |
| CX11839 | tyra-3(ok325) X. | C. elegans | Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX12708 | ggr-2(lf62) X. | C. elegans | Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX12709 | avr-14(ad1302) I. | C. elegans | Decreased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX12724 | acc-4(ok2371) III. | C. elegans | Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX12725 | inx-20(ok681) I. | C. elegans | Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX12726 | inx-9(ok1502) IV. | C. elegans | Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX12800 | ser-3(ad1774) I. | C. elegans | Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX13079 | octr-1(ok371) X. | C. elegans | Derived by outcrossing VC224 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX13111 | dop-5(ok568) V. | C. elegans | Derived by outcrossing RB785 three times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX13325 | inx-2(ok376) X. | C. elegans | Derived by outcrossing VC260 four times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX14295 | pdfr-1(ok3425) III. | C. elegans | Decreased locomotion on food. Derived by outcrossing VC2609 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX14394 | npr-5(ok1583) V. | C. elegans | Derived by outcrossing RB1393 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35. |
| CX17256 | kyIs722. | C. elegans | kyIs722 [str-2p::GCaMP5(D380Y) + elt-2::mCherry]. GCaMP5a expression driven by str-2 promoter, providing a very bright integrated calcium indicator useful for imaging of AWC(on). |
| CX188 | dig-1(ky188) III; kyIs4 X. | C. elegans | kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX20 | adp-1(ky20) II. | C. elegans | Defective in adaptation to a subset of AWC-sensed odorants. Dominant. |
| CX2065 | odr-1(n1936) X. | C. elegans | Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.] |
| CX2205 | odr-3(n2150) V. | C. elegans | Defective chemotaxis to many volative odorants. Defective osmotic avoidance (osm). Defective chemotaxis to some water-soluble attractants (che). |
| CX2304 | odr-2(n2145) V. | C. elegans | Defective chemotaxis to some volatile odorants: benzaldehyde, isoamyl alcohol. |
| CX2357 | odr-5(ky9) X. | C. elegans | Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. Linked sterility has not been separated from Odr phenotype. |
| CX2386 | odr-8(ky31) IV. | C. elegans | |
| CX2398 | odr-8(ky41) IV. | C. elegans | |
| CX2565 | kyIs4 lin-15B&lin-15A(n765) X. | C. elegans | kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX2610 | lin-15B&lin-15A(n765) kyIs30 X. | C. elegans | kyIs30 [glr-1::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX2914 | nDf16/dpy-17(e164) unc-32(e189) III. | C. elegans | Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. The DpyUncs will outgrow the hets. |
| CX2993 | sax-7(ky146) IV; kyIs4 X. | C. elegans | kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3019 | mut-2(r459) I; dpy-19(n1347) glr-1(ky176) III. | C. elegans | Nose touch defective (recessive). Mechanosensory defective (semi-dominant). Mildly Dpy (ts). |
| CX3125 | sax-6(ky214) I; kyIs4 X. | C. elegans | kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-6 is temperature sensitive. Posterior axon from amphid neuron. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3137 | sax-9(ky212) IV; kyIs4 X. | C. elegans | kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-9 is temperature senstive. Amphid axon guidance defects (termination, guidance). This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3171 | sax-3(ky200) X. | C. elegans | Defective in the axon guidance of neurons. Maintain at 20C or 25C. |
| CX3198 | sax-3(ky123) X. | C. elegans | sax-3 mutants have an anteriorly-displaced nerve ring, defects in axon guidance to the ventral midline, and extra axon crossing at the ventral midline. There are also defects in CAN and HSN cell migration, a notched head and an Egl phenotype. This allele is 80% lethal in embryonic stages. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX32 | odr-10(ky32) X. | C. elegans | Impaired chemotaxis to low concentrations of the odorant diacetyl. |
| CX3222 | odr-3(n1605) V. | C. elegans | Reference: Roayaie K, et al. Neuron. 1998 Jan;20(1):55-67. |
| CX3260 | kyIs37 II. | C. elegans | kyIs37 [odr-10::GFP + lin-15(+)] II. No lin-15 mutation in background. Translational fusion; first few amino acids of odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3344 | kyIs53 X. | C. elegans | kyIs53[odr-10::GFP]. Full length odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3385 | sax-2(ky216) III. | C. elegans | Temperature sensitive. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3410 | odr-10(ky225) X. | C. elegans | Impaired chemotaxis to low concentrations of the odorant diacetyl. ky225 is a 1351 bp deletion removing all coding sequence past the N-terminal 120 amino acids. |
| CX3465 | kyIs39. | C. elegans | kyIs39 [sra-6::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3493 | sax-5(ky118) IV. | C. elegans | Amphid axon guidence defect. HSN axon guidence defect. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3553 | lin-15B&lin-15A(n765) kyIs104 X. | C. elegans | kyIs104 [str-1p::GFP] X. AWB expression of GFP. |
| CX3572 | kyIs105 V; lin-15B&lin-15A(n765) X. | C. elegans | kyIs105 [str-3p::snb-1::GFP + lin-15(+)]. Also known as str-3::VAMP::GFP or ASI::VAMP::GFP or M7::VAMP::GFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3596 | kyIs128 lin-15B&lin-15A(n765) X. | C. elegans | kyIs128 [str-3::GFP + lin-15(+)]. kyIs128 encodes a translational fusion contaning 4aa coding sequence (M7.13::GFP). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3695 | kyIs140 I. | C. elegans | kyIs140 [str-2::GFP + lin-15(+)] I. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3716 | lin-15B&lin-15A(n765) kyIs141 X. | C. elegans | kyIs141[osm-9::GFP5 + lin-15(+)]. GFP in sensory neurons. |
| CX3877 | kyIs156 X. | C. elegans | kyIs156 [str-1p::odr-10(cDNA)::GFP]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX3933 | kyIs140 I; slo-1(ky389) V. | C. elegans | kyIs140 [str-2::GFP + lin-15(+)]. ky389 is semi-dominant. str-2::GFP is expressed in both AWC neurons in ky389 mutants. PKA nsy-3(ky389). |
| CX3937 | lim-4(ky403) X. | C. elegans | Coily movement; aberrent head movement. The AWB neurons are transformed towards the AWC neuron fate by many criteria. |
| CX3940 | kyIs140 I; rol-6(e187) II; slo-1(ky399) V. | C. elegans | kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX4 | odr-7(ky4) X. | C. elegans | odr-7 mutants fail to respond to odorants sensed by the AWA neurons. |
| CX4103 | kyIs150 IV; sax-1(ky491) X. | C. elegans | kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX4148 | npr-1(ky13) X. | C. elegans | |
| CX4533 | ocr-1(ok132) V. | C. elegans | Double mutants with ocr-2 have reduced AWA gene expression. |
| CX4534 | ocr-1(ak46) V. | C. elegans | Double mutants with ocr-2 have reduced AWA gene expression. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX4544 | ocr-2(ak47) IV. | C. elegans | Chemosensory, mechanosensory, and osmosensory defects. Null allele. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX4828 | kyIs140 I; tir-1(ky388) III; him-5(e1490) V. | C. elegans | kyIs140 [str-2::GFP + lin-15(+)] I. Him. In tir-1 mutants str-2::GFP is expressed in both AWC neurons. |
| CX4998 | kyIs140 I; nsy-1(ky397) II. | C. elegans | kyIs140 [str-2::GFP + lin-15(+)] I. In nsy-1 mutants str-2::GFP is expressed in both AWC neurons. |
| CX5000 | slt-1(eh15) X. | C. elegans | slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant. |
| CX5156 | sad-1(ky289) X. | C. elegans | |
| CX5346 | slt-1(ev740) X. | C. elegans | AVM axon guidance defect. |
| CX5347 | slt-1(ev741) X. | C. elegans | AVM axon guidance defect. |
| CX5463 | slt-1(ok255) X. | C. elegans | Viable. Can be scored only using special neuronal markers such as zdIs5 [mec-4p::GFP + lin-15(+)], which labels the touch cells and shows that they have aberrant anterior processes in the slt-1 mutant. |
| CX5478 | lin-15B&lin-15A(n765) X; kyEx581. | C. elegans | kyEx581 [ocr-4::GFP + lin-15(+)]. GFP expression in OLQS. Maintain by picking non-Muv. |
| CX5757 | kyIs140 I; nsy-4(ky616) IV. | C. elegans | kyIs140 [str-2::GFP + lin-15(+)] I. 2-AWC OFF. |
| CX5893 | kyIs140 I; ceh-36(ky646) X. | C. elegans | kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-36 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX5922 | kyIs140 I; ceh-36(ky640) X. | C. elegans | kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-26 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX5974 | kyIs262 IV. | C. elegans | kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. |
| CX6161 | inx-19(ky634) I. | C. elegans | Previously called nsy-5. |
| CX6391 | syg-2(ky671) X. | C. elegans | Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Originally had kyEx648 [unc-86 + syg-1::GFP] in this strain, but the CGC stock does not contain the array. |
| CX6448 | gcy-35(ok769) I. | C. elegans | 668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'. |
| CX652 | kyIs235 V; syg-1(ky652) X. | C. elegans | kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| CX6632 | kyEx728. | C. elegans | kyEx728 [sra-6p::G-CaMP]. No co-injection marker -- pick GFP+ animals to maintain. |
| CX6827 | eat-4(ky5) III; kyEx844. | C. elegans | kyEx844 contains [odr-3::eat-4 + elt-2::GFP]. |
| CX7102 | lin-15B&lin-15A(n765) qaIs2241 X. | C. elegans | qaIs2241 [gcy-36::egl-1 + gcy-35::GFP + lin-15(+)]. |
| CX9683 | gcy-31(ok296) X; kyEx2116. | C. elegans | kyEx2116 contains [gcy-31::SL2::GFP + odr-1::DsRed2]. |
| CZ3714 | gcy-31(ok296) X. | C. elegans | 2505bp deletion in cosmid T07D1. Break points are 6562 and 9069 with respect to T07D1. Sequence at the break point is: GGAAAAAAAAACTTCGCG / TTTGGCTAGTCGTAT. Primers: ok296u1: CTGAAACCATCTGACAGA; ok296d1: CATCGGAATAGGATTGTTG; ok296d2: CATTAGGTTTACAGGCTTAG. ok296d1u1 = 290bp product with WT allele. ok296d2u1 = 352 bp product with ok296 allele. |
| CZ3715 | gcy-33(ok232) V. | C. elegans | 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele. |
| MT5300 | odr-4(n2144) III. | C. elegans | Defective chemotaxis to some volatile odorants: benzaldehyde, diacetyl,2,4,5-trimethyl thiazole. Chemotaxis defect is temperature sensitive. |
| TL24 | zdIs5 I; clr-1(cy14) II; slt-1(eh15) X. | C. elegans | zdIs5 [mec-4p::GFP + lin-15(+)] I. cy14 was isolated in a screen for suppressors of the AVM axon ventral guidance defect of slt-1 null mutant. cy14 is a G-to-A transition in the splice acceptor of intron 5 of clr-1 that leads to the use of a cryptic splice acceptor and consequently to an 18 bp deletion in exon 6. |
| WE5236 | pgIR1 (I, CB4856>N2) I. | C. elegans | pgIR1 (I, CB4856>N2). CB4856 Chromosome I in N2 background. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| ky1018 | Allele | substitution | nonsense |
| ky1 | Allele | ||
| ky10 | Allele | ||
| ky867 | Allele | substitution | nonsense |
| ky188 | Allele | ||
| ky20 | Allele | substitution | |
| ky9 | Allele | ||
| ky31 | Allele | substitution | |
| ky41 | Allele | ||
| ky146 | Allele | substitution | nonsense |
| ky176 | Allele | ||
| ky214 | Allele | ||
| ky212 | Allele | ||
| ky200 | Allele | ||
| ky123 | Allele | ||
| ky32 | Allele | ||
| ky216 | Allele | substitution | nonsense |
| ky225 | Allele | ||
| ky118 | Allele | ||
| ky275 | Allele | ||
| ky389 | Allele | substitution | |
| ky403 | Allele | substitution | nonsense |
| ky399 | Allele | substitution | |
| ky4 | Allele | substitution | nonsense |
| ky211 | Allele | ||
| ky13 | Allele | substitution | nonsense |
| ky388 | Allele | substitution | nonsense |
| ky397 | Allele | substitution | nonsense |
| ky51 | Allele | substitution | |
| ky289 | Allele | substitution | |
| ky616 | Allele | substitution | |
| ky646 | Allele | substitution | nonsense |
| ky640 | Allele | substitution | nonsense |
| ky634 | Allele | substitution | |
| ky671 | Allele | substitution | |
| ky652 | Allele | deletion | frameshift |
| ky5 | Allele | deletion | |
| ky535 | Allele | ||
| ky651 | Allele | substitution | splice_site |