Search Strains

More Fields
Strain Species Genotype Add
BC4964 C. elegans sEx164. Show Description
sEx164 [ZK418 (III) + pCes1943[rol-6(su1006)]]. 8 ng/ul mini-prepped cosmid ZK418 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
CHS1238 C. elegans f07b10.4(yum2454) f07b10.7(yum2455) f59b1.6(yum2456) zk418.7(yum2457) w08g11.5(yum2458) r10e8.5(yum2459) zk418.6(yum2460) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
RB1932 C. elegans ZK418.8(ok2535) III. Show Description
ZK418.8 Homozygous. Outer Left Sequence: aaaaccggtgaagtttgagg. Outer Right Sequence: catttgcgaaatgggaaagt. Inner Left Sequence: ttttcgagctacaacgacttttt. Inner Right Sequence: attgcgagcccatttgttat. Inner Primer PCR Length: 3125. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3531 C. elegans ZK418.10(ve1031[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 2100 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAAATAATGAAAAAAATACAGTAATACAA ; Right flanking sequence: TGGCTCTATTTTTTGGAGTTGATATACATA. ZK418.10 crRNA A: TGAAATTCAGGGAACGTGAG; ZK418.10 crRNA B: TACACCATAGATTTTCAACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC1863 C. elegans ZK418.9(ok2248) III. Show Description
ZK418.9. External left primer: AATACTTCGTCGCAGTGCCT. External right primer: ACTGCCAATTTTTCGAATGG. Internal left primer: AAACGAGATCGGCACAATTC. Internal right primer: TGGTGGCATTGGAACACTAA. Internal WT amplicon: 2302 bp. Deletion size: 966 bp. Deletion left flank: ACACTGGCTTGTGGTTGTTGCATAGGATTC. Deletion right flank: GAAGTGGCTTCGGCTGGCCAGTTGCAGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2615 C. elegans ZK418.13(ok3092) III. Show Description
ZK418.13. External left primer: CGCGCTTTATTGAGAACCAT. External right primer: TTTCCGAGGGTACGCTTCTA. Internal left primer: GCGCGAAGTTTGAATAGGAC. Internal right primer: GCGGCCACGTAGTAGAAAAA. Internal WT amplicon: 1264 bp. Deletion size: 446 bp. Deletion left flank: GACGGAGGCGATACGGGCGGTGGCTTCATG. Deletion right flank: GCATGTTTGCTCATAGAGCTTACACCACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807