Search Strains

More Fields
Strain Species Genotype Add
RG3290 C. elegans rnp-6(ve790[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC20 [dpy-5(tm9709)] I. Show Description
Early larval arrest. Deletion of 7256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain KR16. unc-11 dpy-5 homozygotes no longer carrying the duplication were outcrossed 5 times to N2 to remove dpy-5; however, unc-11 may still be in the background. rnp-6 deletion was balanced over tmC20 [dpy-5(tm9709)] by crossing with strain FX30235. Balanced heterozygotes are semi-Dpy GFP+, and segregate semi-Dpy GFP+, early larval lethal GFP+ (ve790 homozygotes), and non-GFP dpy-5 animals (tmC20 homozygotes). Maintain by picking semi-dpy GFP+. Left flanking Sequence: attaaaaacatggaggaattcgagaataca ; Right flanking sequence: GCCTGTTTTCGATGTCTGCCGAGTTTTCTT. sgRNA #4: TGGAAATACTGTCAAAGCGG; sgRNA #2: AGACATCGAAAACAGGCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.