Search Strains

Amplify with the following external primers: EL1(agtcctgaacggagctttga); ER1(tacaatggcagcagcaagtc). Then re-amplify with the nested primer set: IL1(tcgcacattggtttgttgtt); IR1(aacggcatgagttagccaat).

K07B1.3. Homozygous. Outer Left Sequence: AGTCCTGAACGGAGCTTTGA. Outer Right Sequence: TACAATGGCAGCAGCAAGTC. Inner Left Sequence: TCGCACATTGGTTTGTTGTT. Inner Right Sequence: AACGGCATGAGTTAGCCAAT. Inner primer WT PCR product: 2995. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

qySi313 [lin-29p::ucp-4::SL2::mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR] I. qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR. Anchor cell specific overexpression of mitochondrial uncoupling protein, UCP-4, (expression confirmed by presence of red anchor cell membrane). qySi313 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.

gaEx192 [sod-3p::mCherry + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.

gaEx214 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.

gaEx218 [sod-3p::mCherry + aakg-2(sta2) + lys-1p::lyz(D. rerio) + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.

gaEx223 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + hsf-1(+) + lys-1p::lyz(D. rario) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.