Search Strains

More Fields
Strain Species Genotype Add
DG2179 C. elegans tub-1(nr2044) II. Show Description
RB1600 C. elegans tub-1(ok1972) II. Show Description
F10B5.4. Homozygous. Outer Left Sequence: ATGATGATGGGACGGAACAT. Outer Right Sequence: TTTTGACACACCACACGCTT. Inner Left Sequence: TGGGACAAGGAAAATCGAAC. Inner Right Sequence: CGGCTTGTTTCCAATCATTT. Inner Primer PCR Length: 2809 bp. Deletion Size: 1676 bp. Deletion left flank: AATTGCATTGAAACCTTTAAAAAGAGTTTC. Deletion right flank: ATGCTCACAGAAACCGATGAGTTATCAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GR1428 C. elegans mgIs45 I. Show Description
mgIs45 [mir-84(+) + tub-1::GFP] I. mir-84 over-expressing line. Reference: Hayes GD, Riedel CG, Ruvkun G. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1589 C. elegans mgIs45 I; somi-1(mg431) wIs54 V. Show Description
mgIs45 [mir-84(over-expressing) + tub-1::GFP] I. wIs54 [scm::GFP] V. Maintain by picking animals with good expression of tub-1::GFP in amphid neurons to maintain. somi-1 mutation suppresses precocious development of the vulva and hypodermal cells caused by over-expression of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
HT1011 C. elegans lpIs100. Show Description
lpIs100 [tub-1::GFP + rol-6(su1006)]. Rollers. Reference: Mukhopadhyay A, et al. Cell Metab. 2005 Jul;2(1):35-42.
HT1037 C. elegans lpIs101. Show Description
lpIs101 [tub-1::GFP + rol-6(su1006)]. Rollers. Reference: Mukhopadhyay A, et al. Cell Metab. 2005 Jul;2(1):35-42.
RG3448 C. elegans otub-1(ve948[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTTTCTTCTCTAAAAATTAAACATTTT ; Right flanking sequence: GATGTGCTCTCTCTTTCTCATCACCACTCC. otub-1 sgRNA A: CTTACAGGTAACAGGAACTA; otub-1 sgRNA B: GGGAGAGAAGACAAGAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.