Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
DA2100 C. elegans ser-7(tm1325) X. Show Description
Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.
DA2109 C. elegans ser-7(tm1325) ser-1(ok345) X. Show Description
F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.
SWF155 C elegans ser-7(tm1325) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF302 C elegans ser-5(tm2647) I; ser-4(flv7) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF380 C elegans ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF420 C elegans ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF469 C elegans ser-5(tm2647) I; lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF800 C elegans ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF911 C elegans ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.