Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CZ20215 C. elegans tba-1(ju89) I. Show Description
Gain-of-function allele isolated sem-4; juIs1 screen in 1997. ju89 has slightly semi-dominant effects, and the gf phenotype is most obvious in homozygous. This outcrossed strain does not carry a sem-4 mutation or juIs1. References: Kurup N, et al. Curr Biol. 2015 Jun 15;25(12):1594-605. Kurup N, et al. PLoS Genet. 2017 Jun 21;13(6):e1006844.
EU1135 C. elegans tba-1(or346) I. Show Description
Dominant, conditional, maternal-effect. At 15C, almost all embryos hatch from or346/+ and or346/or346 mothers. At25C, about 85% of embryos die from or346/+ mothers and about 100% of embryos die from or346/or346 mothers.
EU1161 C. elegans tba-1(or594) I. Show Description
Semi-dominant. Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
RB1182 C. elegans tba-1(ok1123) I. Show Description
F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence:cagcccgactttcatttctc . Inner Primer PCR Length: 2176. Estimated Deletion Size: about 1100 bp. Received new stock 11/04/04. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1185 C. elegans tba-1(ok1135) I. Show Description
F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence: cagcccgactttcatttctc. Inner Primer PCR Length: 2176. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GN675 C. elegans tba-1(pg77[tba-1::TagRFP-T + loxP]) I; uIs31 III. Show Description
uIs31 [mec-17p::GFP] III. pg77[tba-1::TagRFP-T + loxP] is a CRISPR-mediated c-external tag in the endogenous tba-1 locus. Reference: Lockhead D. et al Mol Biol Cell. 2016 Nov 15; 27(23): 3717–3728.
GN683 C. elegans tbb-1(pg79[tbb-1::TagRFP-T + loxP]) uIs31 III. Show Description
uIs31 [mec-17p::GFP] III. pg79[TBB-1::TagRFP-T + loxP] is a CRISPR-mediated c-external tag in the endogenous tba-1 locus. Reference: Lockhead D. et al Mol Biol Cell. 2016 Nov 15; 27(23): 3717–3728.
SA1067 C. elegans tba-1(tj44[gfp::TEV::3×FLAG::tba-1]) I. Show Description
GFP tag inserted into the endogenous tba-1 locus. GFP signals are detected at the epidermis, germline, intestine, muscle, and neurons. Reference: Honda Y, et al. J. Cell. Sci. 2017 May 1;130(9):1652-1661. PMID: 28302908.
STR536 C. elegans hrtEx161. Show Description
hrtEx161 [des-2p::PA-GFP::tba-1 + des-2p::mKate2 + unc-119(+) + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. PA-GFP::TBA-1 expression in PVD and FLP; fluorescence can be induced illumination by blue light. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
TV21720 C. elegans tba-1(ok1135) wyIs813 II. Show Description
wyIs813 [unc-86p::GFP::tba-1 + unc-86p:mCherry::PLCdP]. tba-1(ok1135) is a 1036 bp deletion. Strong expression of GFP::TBA-1 signal, low mCherry::PLCdP signal. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.