Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PHX5321 C. elegans bli-4(syb5321[bli-4::SfGFP(int)]) I. Show Description
bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.