Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PHX3596 C. elegans tph-1(mg280) pah-1(syb3596) II. Show Description
Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX3601 C elegans pah-1(syb3601) II. Show Description
Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.