Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS1009 C. elegans unc-101(sy237) I; sli-1(sy143) X. Show Description
PS1411 C. elegans let-23(sy1) II; sli-1(sy143) X. Show Description
sli-1 is a silent suppressor of the Vul phenotypes of let-23(lf) mutants. sy1;sy143 animals are Hyperinduced. Do not distribute this strain; other labs should request it from the CGC.
PS2728 C. elegans sli-1(sy143) X. Show Description
Do not distribute this strain; other labs should request it from the CGC.
PS746 C. elegans let-23(sy97) II; sli-1(sy143) X. Show Description
sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC.
PS8630 C. elegans oac-44(sy1431) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTCTCGGATTCCACTTCTACCCAAACCAGTTTCC right flanking sequence: CAATGGATACCTCGGAGTGGATCAgttaggtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCCAAACCAGTTTCCCAA Method Reference: G3 (Bethesda).
PS8632 C. elegans oac-42(sy1433) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-42. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTGACTTACAAGGAATTCGGGGTCTCGCCATTG right flanking sequence: CTGCAGTGCTTCTTTATCACTTTTATCCAAAACAA inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATAAAGAAGCACTGCAGCAA Method Reference: G3 (Bethesda).
PS8634 C. elegans col-135(sy1435) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-135. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCAGCGCTCGGGTATAATATTCGATATCCCTCCT right flanking sequence: ATGAACCAAATCGACAATATGGCCCATATTCGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTCGATTTGGTTCATAGG Method Reference: G3 (Bethesda).
PS8636 C. elegans ins-10(sy1437) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAAAAACAATTCTTCTAATCTCATTCTTGCTCCTCGT right flanking sequence: AACATTGGCTCCCAGAACAAGTGCAGCTTTTCCATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTGGGAGCCAATGTTACG Method Reference: G3 (Bethesda).