Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RG3012 C. elegans sra-27(ve512[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CHS1081 C. elegans sra-32(yum1501) sra-27(yum1496) sra-28(yum1497) sra-29(yum1498) sra-31(yum1500) II; sra-30(yum1499) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.