| DCR744 |
C. elegans |
cima-1(wy84) IV; wyIs45 X. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. AIY presynaptic maintenance defect at adult stage (synapses appears in asynaptic Zone 3 region). Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1017 |
C. elegans |
cima-1(wy84) IV; wyIs45 X; olaEx603. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx603 [rab-3p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx605 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1023 |
C. elegans |
cima-1(wy84) IV; wyIs45 X; olaEx609. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx609 [aex-3p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx609 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1078 |
C. elegans |
cima-1(wy84) IV; wyIs45 X; olaEx551. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx551 [cima-1p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx551 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1099 |
C. elegans |
cima-1(wy84) IV; wyIs45 X, olaEx644. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx644 [ttx-3p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx642 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1102 |
C. elegans |
cima-1(wy84) IV; wyIs45 X; olaEx647. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx647 [hlh-17p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx647 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1288 |
C. elegans |
cima-1(wy84) IV; wyIs45 X; olaEx765. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx765 [dpy-7p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx765 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1301 |
C. elegans |
cima-1(wy84) IV; wyIs45 X; olaEx775. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx775 [dpy-4p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx605 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR2335 |
C. elegans |
cima-1(wy84) IV; wyIs45 X; olaEx1411. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1411 [dpy-7p::egl-15(5A)::HA + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR936 |
C. elegans |
cima-1(wy84) IV; wyIs45 X; olaEx559. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx559 [rol-6p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx559 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1337 |
C. elegans |
nsIs105 I; cima-1(wy84) IV; wyIs45 X; olaEx805. Show Description
nsIs105 [hlh-17p::GFP] I. wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx805 [hlh-17p::caspase12 + hlh-17p::caspase17 + ttx-3p::mCherry + glr-3p::mCherry + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Ablation of CEPsh glia partially suppresses AIY presynaptic maintenance defects in cima-1(wy84) mutants. nsIs105 (hlh-17::GFP) expression labels CEPsh glia. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1690 |
C. elegans |
cima-1(wy84) IV; egl-15(n484) wyIs45 X; olaEx1004. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1004 [F25B3.3p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1004 does not rescue egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1710 |
C. elegans |
cima-1(wy84) IV; egl-15(n484) wyIs45 X; olaEx1015. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1015 [dpy-7p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1015 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1779 |
C. elegans |
cima-1(wy84) IV; egl-15(n484) wyIs45 X; olaEx1054. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1054 [dpy-7p::egl-15(5A)(ecto) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1054 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| RG3280 |
C. elegans |
slc-17.2(ve780[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 2131 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCAATCTTTTCTCCTTCTCTAAGTGGAGC ; Right flanking sequence: CGGTTTGGTAGTAGCCCCTTCCATAATTAT. sgRNA #1: CATCTCATGGCCTTCTTCGG; sgRNA #2: TACTTTACGATCAACTCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3383 |
C. elegans |
slc-17.1(ve883[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 3946 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGATATGTTGACCATCTATTCCAGCTGTCC ; Right flanking sequence: TTCGAGAGCCAGTTAGAACTCAAAATGAGT. slc-17.1 sgRNA A: GACAAAGGAAGTGTGCTCTG; slc-17.2 sgRNA B: ACGTTGTGCGAAAAAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3407 |
C. elegans |
slc-17.5(ve907[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTCCCCATTCTTCAGCAGTTCCAACAGTC ; Right flanking sequence: GATAGTGATAATCCGATGTGAGCTGTCATT. slc-17.5 sgRNA A: TTGTAATATGAGATCATGAG; slc-17.5 sgRNA B: ATGTATGTGCAACTCAACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
