Search Strains

Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUnc are abnormal larvae which die in early larval development. Pick WT to maintain.

qpIs97 [exc-9p::mCherry::rab-11] V. Expression of mCherry-tagged RAB-11 of recycling endosomes in cytoplasm of excretory canals along nearly entire length of worm. Generated in N2 background. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.

Temperature sensitive. Maintain at 15C. Formerly known as mat-2.

vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab].

vsIs13 [lin-11::pes-10::GFP + lin-15(+)]. GFP expression in six VC neurons and posterior intestine. vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab]. vsIs100 [myo-3p::CFP + lin-15(+)]. CFP expression in VMs. Additional background expression seen as punctate nucleolar fluorescence along the ventral side of the worm (also present in wild-type).

mirIs97 [15XUAS::ACR1::let-858 3'UTR *oxTi677 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] II. Superficially wildtype. Integration of multicopy UAS::ACR1 array into tdTomato in the oxTi677 insertion. Genotype for UAS::ACR1 with primers 5'-atgagcagcatcacctgtgat-3' and 5'-ttaggtctcgccggctct-3' to obtain a ~900 bp band.

cdIs97 [pcc1::mCherry::cup-5 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::CUP-5 expressed in front coelomocyte promoter.

ynIs97 [flp-1p::GFP].

ddIs97 [F47G4.6::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wbmIs97 [eft-3p::tomm-20(aa1-49)::GFP::unc-54 3'UTR] *wbmIs65. Somatic-specific TOMM-20(1-49)::GFP expression driven by the eft-3p promoter allows imaging of mitochondria without some of the adverse side effects of extrachromosomal arrays. Derived by CRISPR-mediated insertion of TOMM-20::GFP downstream of tissue-specific eft-3 promoter of wbmIs65 insertion in parental strain WBM1140. wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.

jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for the mechanosensory neurons. ju1903 deletion removes N-terminus of EFA-6 and disrupts all known isoforms. No visible GFP::EFA-6 due to ju1903 deletion. Reference: Sandhu A., et al. Cell Reports 2024 Oct 22;43(10):114776. doi: 10.1016/j.celrep.2024.114776. PMID: 39305484.

L268P mutation introduced in ?-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

jsIs973 [mec-7p::mRFP + unc-119(+)] III. jsIs609 [mec7p::mtGFP + lin-15(+)] X. Strong RFP cytosolic marker for the mechanosensory neurons (Zheng et al. 2011, PMID 21115607). GFP mitochondrial marker expressed in mechanosensory neurons (Mondal et al. 2012, PMID 23051668).

jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607).

jsIs973 [mec-7p::mRFP + unc-119(+)] III.  oxIs12 [unc-47p::GFP + lin-15(+)] X. oxIs12 integration maps at +2.0 on X. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607). Expression of GFP in all GABAergic neurons.

ccIs9753 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Medium-strength GFP signal. See WBG 15 #5 page 20.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of asp-12. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAATCGCCAAAGATGCAAATGATGAGGCGAGGAGA. Right flanking sequence: ATGGGGAGCATACGTTCAACACAAGGCTGCCCTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGATGAGGCGAGGAGAATG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 2nd exon of the gene. Left flanking sequence: catatattttcccgttttttgcagCTTTTCCAGCT. Right flanking sequence: ATCCATGGCTTCACAAACCGATTTCAAGGACAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTGTGAAGCCATGGATAGC Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-110. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGGTTTTGACGGTTGGAGCAATGGTAACCCTTCC right flanking sequence: ACTAGCCTATCATTATGTTAATCAGTTGAGAAATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATAATGATAGGCTAGTGGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-32 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgtctgaaaATGACCTCGATTCTGTTGATCCTTC. Right flanking sequence: TATTGGTTATCACCGTCACCGGGATGTTCCAGGAG Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATTCTGTTGATCCTTCTAT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: ctctgcactggattcccattcggagcacATGGTAC. Right flanking sequence: AAGAGGCGTTGAATAATGTGATGAAGGGCCGAACTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCGGAGCACATGGTACAAG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tat-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGTGGCAGAATCCTAAAAACGCATCCAGTAACA. Right flanking sequence: CGATGGCTGTTCCCAACTCAACCCATGCTTCCAC Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACGCATCCAGTAACACGA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Lineage defects in B, F & U blast cells resulting in abnormal spicules and ectopic spicule cells. F34D10.5 rescues lin-48(sy234); it encodes a C2H2 zinc finger protein similar to Drosophila ovo. Do not distribute this strain; other labs should request it from the CGC.