Search Strains

More Fields
Strain Species Genotype Add
BC149 C. elegans dpy-14(e188) unc-13(e51) let-83(s97)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUnc are abnormal larvae which die in early larval development. Pick WT to maintain.
BK205 C. elegans qpIs97 V. Show Description
qpIs97 [exc-9p::mCherry::rab-11] V. Expression of mCherry-tagged RAB-11 of recycling endosomes in cytoplasm of excretory canals along nearly entire length of worm. Generated in N2 background. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
DS97 C. elegans apc-1(ax76) II. Show Description
Temperature sensitive. Maintain at 15C. Formerly known as mat-2.
LX960 C. elegans lin-15B&lin-15A(n765) X; vsIs97. Show Description
vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab].
LX975 C. elegans vsIs13 IV; lin-15B&lin-15A(n765) X; vsIs97; vsIs100. Show Description
vsIs13 [lin-11::pes-10::GFP + lin-15(+)]. GFP expression in six VC neurons and posterior intestine. vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab]. vsIs100 [myo-3p::CFP + lin-15(+)]. CFP expression in VMs. Additional background expression seen as punctate nucleolar fluorescence along the ventral side of the worm (also present in wild-type).
MSB952 C. elegans mirIs97 [*oxTi677] II; unc-119(ed3) III. Show Description
mirIs97 [15XUAS::ACR1::let-858 3'UTR *oxTi677 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] II. Superficially wildtype. Integration of multicopy UAS::ACR1 array into tdTomato in the oxTi677 insertion. Genotype for UAS::ACR1 with primers 5'-atgagcagcatcacctgtgat-3' and 5'-ttaggtctcgccggctct-3' to obtain a ~900 bp band.
NP1054 C. elegans unc-119(ed3) III; cdIs97. Show Description
cdIs97 [pcc1::mCherry::cup-5 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::CUP-5 expressed in front coelomocyte promoter.
NY2097 C. elegans ynIs97. Show Description
ynIs97 [flp-1p::GFP].
TH175 C. elegans unc-119(ed3)III; ddIs97. Show Description
ddIs97 [F47G4.6::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
WBM1231 C. elegans wbmIs97 *wbmIs65. Show Description
wbmIs97 [eft-3p::tomm-20(aa1-49)::GFP::unc-54 3'UTR] *wbmIs65. Somatic-specific TOMM-20(1-49)::GFP expression driven by the eft-3p promoter allows imaging of mitochondria without some of the adverse side effects of extrachromosomal arrays. Derived by CRISPR-mediated insertion of TOMM-20::GFP downstream of tissue-specific eft-3 promoter of wbmIs65 insertion in parental strain WBM1140. wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.
CZ29092 C. elegans jsIs973 III; efa-6(*ju1658[GFP::efa-6] ju1903) IV. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for the mechanosensory neurons. ju1903 deletion removes N-terminus of EFA-6 and disrupts all known isoforms. No visible GFP::EFA-6 due to ju1903 deletion. Reference: Sandhu A., et al. Cell Reports 2024 Oct 22;43(10):114776. doi: 10.1016/j.celrep.2024.114776. PMID: 39305484.
GOU3238 C. elegans spc-1(cas971[spc-1(L268P)]) X. Show Description
L268P mutation introduced in ?-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
NM4244 C. elegans jsIs973 III; jsIs609 X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. jsIs609 [mec7p::mtGFP + lin-15(+)] X. Strong RFP cytosolic marker for the mechanosensory neurons (Zheng et al. 2011, PMID 21115607). GFP mitochondrial marker expressed in mechanosensory neurons (Mondal et al. 2012, PMID 23051668).
NM4397 C. elegans jsIs973 III; ptrn-1(js1286) X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607).
NM4422 C. elegans jsIs973 III; oxIs12 ptrn-1(tm5597) X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III.  oxIs12 [unc-47p::GFP + lin-15(+)] X. oxIs12 integration maps at +2.0 on X. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607). Expression of GFP in all GABAergic neurons.
PD9753 C. elegans ccIs9753 I. Show Description
ccIs9753 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Medium-strength GFP signal. See WBG 15 #5 page 20.
PS9705 C. elegans asp-12(sy1899) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of asp-12. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAATCGCCAAAGATGCAAATGATGAGGCGAGGAGA. Right flanking sequence: ATGGGGAGCATACGTTCAACACAAGGCTGCCCTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGATGAGGCGAGGAGAATG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9707 C. elegans haf-6(sy1901) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 2nd exon of the gene. Left flanking sequence: catatattttcccgttttttgcagCTTTTCCAGCT. Right flanking sequence: ATCCATGGCTTCACAAACCGATTTCAAGGACAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTGTGAAGCCATGGATAGC Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9711 C. elegans col-110(sy1737) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-110. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGGTTTTGACGGTTGGAGCAATGGTAACCCTTCC right flanking sequence: ACTAGCCTATCATTATGTTAATCAGTTGAGAAATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATAATGATAGGCTAGTGGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9712 C. elegans ins-32(sy1905) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-32 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgtctgaaaATGACCTCGATTCTGTTGATCCTTC. Right flanking sequence: TATTGGTTATCACCGTCACCGGGATGTTCCAGGAG Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATTCTGTTGATCCTTCTAT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9714 C. elegans haf-6(sy1907) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: ctctgcactggattcccattcggagcacATGGTAC. Right flanking sequence: AAGAGGCGTTGAATAATGTGATGAAGGGCCGAACTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCGGAGCACATGGTACAAG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS9716 C. elegans tat-3(sy1914) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tat-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGTGGCAGAATCCTAAAAACGCATCCAGTAACA. Right flanking sequence: CGATGGCTGTTCCCAACTCAACCCATGCTTCCAC Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACGCATCCAGTAACACGA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
PS976 C. elegans lin-48(sy234) III; him-5(e1490) V. Show Description
Lineage defects in B, F & U blast cells resulting in abnormal spicules and ectopic spicule cells. F34D10.5 rescues lin-48(sy234); it encodes a C2H2 zinc finger protein similar to Drosophila ovo. Do not distribute this strain; other labs should request it from the CGC.