| AY157 |
C. elegans |
gon-2(q388) I; acEx157. Show Description
acEx157 [gon-2p::gon-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in intestine and gonads). gon-2 expression driven by gon-2 promoter. Transgene rescues gon-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
|
|
| AY158 |
C. elegans |
gon-2(q388) I; acEx158. Show Description
acEx158 [ges-1p::gon-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in intestinal cells). gon-2 expression driven by ges-1 promoter. Transgene rescues gon-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
|
|
| EJ1158 |
C. elegans |
gon-2(q388) I. Show Description
NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] Reference: Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.
|
|
| EJ1171 |
C. elegans |
gon-2(q388) I; gem-1(bc364) X. Show Description
NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.
|
|
| EJ808 |
C. elegans |
gem-4(dx77) IV. Show Description
No apparent phenotype. Suppressor of gon-2(q388).
|
|
| MQD2402 |
C. elegans |
daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III; hqSi12 IV. Show Description
hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2495 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; daf-2(e1370) unc-119(ed3) III; hqSi12 IV. Show Description
hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|