Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
OH3926 C. elegans otIs114 I; nhr-67(ot136) IV. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Shows ASE asymmetry defects. Mildly temperature sensitive. Maintain at 25C.
OT136 C. elegans mua-3(rh195) III. Show Description
Weak recessive allele of mua-3. 40% have muscle detachment from cuticle in adults, primarily in head, results in weak bent head phenotype. 60% are wild type.
OH18508 C. elegans daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV. Show Description
ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.