Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RM2710 C. elegans snf-11(ok156) V. Show Description
Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
RM2711 C. elegans unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
RM2717 C. elegans snf-3(ok293) II; unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially the same as unc-25 mutants (Shrinker, Exp, etc.). Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 and unc-25; snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
RM2718 C. elegans snf-3(ok293) II; snf-11(ok156) V. Show Description
Superficially wild-type. Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
RB1375 C. elegans C44H4.6(ok1560) X. Show Description
C44H4.6 Homozygous. Outer Left Sequence: catctgtttgcggactttga. Outer Right Sequence: ctctgtgcatgtttgcgttt. Inner Left Sequence: ctttgtcgccttcctcactc. Inner Right Sequence: caatggctaggatcccaaaa. Inner Primer PCR Length: 2778. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1376 C. elegans rab-33&taf-11.3(ok1561) III. Show Description
F43D9.5, F43D9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1377 C. elegans acs-17(ok1562) X. Show Description
C46F4.2 Homozygous. Outer Left Sequence: ggtcgattcttcgatttcca. Outer Right Sequence: tggggagcataggtttttca. Inner Left Sequence: cctaaaacatatggccaccg. Inner Right Sequence: tgaacgcacggtatgtttgt. Inner Primer PCR Length: 3216. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1379 C. elegans F11C7.1(ok1564) X. Show Description
F11C7.1 Homozygous. Outer Left Sequence: gcaaacgccaataactggat. Outer Right Sequence: atgtgaaagcctacgccaac. Inner Left Sequence: tgcctgatctctcattgtgc. Inner Right Sequence: atccaattcggtggactcag. Inner Primer PCR Length: 3214. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1380 C. elegans C11D2.2(ok1565) IV. Show Description
C11D2.2 Homozygous. Outer Left Sequence: aggccgattgcattgataag. Outer Right Sequence: ggggcaattttcaacaaaaa. Inner Left Sequence: ggtttgatcgacttgttggg. Inner Right Sequence: cccgatccgtttattcttga. Inner Primer PCR Length:3169. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1381 C. elegans F52B5.1(ok1566) I. Show Description
F52B5.1 Homozygous. Outer Left Sequence: agtggggaaggctttcaaat. Outer Right Sequence: ctattggccccaattgtcac. Inner Left Sequence: gacaaagaggcggagtgaag. Inner Right Sequence: ccgattctgggttcatgtct. Inner Primer PCR Length: 3124. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1382 C. elegans C08G5.5(ok1567) II. Show Description
C08G5.5 Homozygous. Outer Left Sequence: attgggggattttccaagac. Outer Right Sequence: actagttttgggcatggtgc. Inner Left Sequence: ccgcgagcaaaatacctaaa. Inner Right Sequence: gctttaagcttcggctgttg. Inner Primer PCR Length: 2200. Estimated Deletion Size: about 750 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1383 C. elegans C47E8.8(ok1568) V. Show Description
C47E8.8 Homozygous. Outer Left Sequence: cgtctggcaaaacttttcgt. Outer Right Sequence: atcattcgctcgagttctgg. Inner Left Sequence: aaaatcattccgatgatgcc. Inner Right Sequence: tcagcttcttcctggtcgat. Inner Primer PCR Length: 3215. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1384 C. elegans dod-21&C32H11.11(ok1569) IV. Show Description
C32H11.10, C32H11.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807