Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
KP987 C. elegans lin-15B&lin-15A(n765) nuIs1 X. Show Description
nuIs1 [glr-1p::GFP + glr-1(+) + lin-15(+)] X. GFP expression in 17 classes of neurons after 3-fold (see WBPaper00002309). This strain is WT at glr-1.
HA2823 C.elegans smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. Show Description
nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.
HA2825 C.elegans smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. Show Description
rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
HA3 C. elegans nuIs11. Show Description
nuIs11 [osm-10::GFP + lin-15(+)]. Array contains pool28; KP#57-59 (osm-10::GFP insert at Nrul site) and pJM24 [lin-15(+) rescues n765 at 20C]. GFP expressed in ASH, ASI, PHA and PHB after 3-fold. nuIs11 may be inserted on LG I.
KP3085 C. elegans nuIs122 IV. Show Description
nuIs122 [acr-2p::pHluorin::snb-1 + myo-2p::dsRed2] IV. Integrated transgene expressing synaptopHluorin under a cholinergic promoter for imaging motor neuron synapses.
KP3814 C. elegans nuIs152 II. Show Description
nuIs152 [unc-129p::GFP::snb-1 + ttx-3p::mRFP] II.
KP3947 C. elegans nuIs183. Show Description
nuIs183 [unc-129p::nlp-21::Venus + myo-2p::GFP]. [NOTE: nuIs183 was previously described as carrying myo-2p::NLS::GFP.] Reference: Sieburth D, et al. Nat Neurosci. 2007 Jan;10(1):49-57.
KP3957 C. elegans nuIs190 X. Show Description
nuIs190 [unc-129p::ins-22::Venus + myo-2p::NLS::GFP] X. Pick GFP+ to maintain. Not all animals express GFP. Array might be prone to silencing or not homozygous. [NOTE: nuIs190 was previously described as carrying myo-2p::GFP without an NLS.] Reference: Ch'ng Q, Sieburth D, Kaplan JM. PLoS Genet. 2008 Nov;4(11):e1000283.
KP3972 C. elegans nuIs184 X. Show Description
nuIs184 [unc-129p::apt-4::GFP + myo-2p::GFP] X.
KP3991 C. elegans nuIs145 V. Show Description
nuIs145 [glr-1p::vps-4(dominant negative)] V. Reference: Chun DK, et al. Mol Biol Cell. 2008 Jul;19(7):2682-95.
KP5445 C. elegans nuIs165. Show Description
nuIs165 [unc-129p::unc-10::GFP + myo-2p::GFP] II.
OH4769 C. elegans ttx-3(mg158) X; nuIs11. Show Description
nuIs11 [osm-10::GFP + lin-15(+)]. Array contains pool28; KP#57-59 (osm-10::GFP insert at Nrul site) and pJM24 [lin-15(+) rescues n765 at 20C]. GFP expressed in ASH, ASI, PHA and PHB after 3-fold. nuIs11 may be inserted on LG I.